chr3-195779135-TGGTGACAGGAAGAGGCGTGGTGTCACCTGTGGATACTGAGGAAAGGCTGGTGACAGGAAGAGGGGTGGCCTGACCTGTGGATGCAGAGGAAGTGTC-T

Position:

• chr3-195779135-TGGTGACAGGAAGAGGCGTGGTGTCACCTGTGGATACTGAGGAAAGGCTGGTGACAGGAAGAGGGGTGGCCTGACCTGTGGATGCAGAGGAAGTGTC-T

Variant summary

Our verdict is Likely benign. Variant got -6 ACMG points: 2P and 8B. PM4 BA1

The NM_018406.7(MUC4):​c.12349_12444del​(p.Asp4117_Thr4148del) variant causes a inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0478 in 132,592 control chromosomes in the GnomAD database, including 141 homozygotes. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.048 (141 hom., cov: 23)
  • Exomes 𝑓: 0.016 (411 hom.)
  • Failed GnomAD Quality Control
• Consequence: MUC4 NM_018406.7 inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 0.541

Genes affected

MUC4 (HGNC:7514): (mucin 4, cell surface associated) The major constituents of mucus, the viscous secretion that covers epithelial surfaces such as those in the trachea, colon, and cervix, are highly glycosylated proteins called mucins. These glycoproteins play important roles in the protection of the epithelial cells and have been implicated in epithelial renewal and differentiation. This gene encodes an integral membrane glycoprotein found on the cell surface, although secreted isoforms may exist. At least two dozen transcript variants of this gene have been found, although for many of them the full-length transcript has not been determined or they are found only in tumor tissues. This gene contains a region in the coding sequence which has a variable number (>100) of 48 nt tandem repeats. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_benign. Variant got -6 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_018406.7.
• BA1: GnomAd4 highest subpopulation (AFR) allele frequency at 95% confidence interval = 0.102 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
MUC4	NM_018406.7	c.12349_12444del	p.Asp4117_Thr4148del	inframe_deletion	2/25	ENST00000463781.8
MUC4	NM_004532.6	c.83-776_83-681del		intron_variant
MUC4	NM_138297.5	c.83-4926_83-4831del		intron_variant

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
MUC4	ENST00000463781.8	c.12349_12444del	p.Asp4117_Thr4148del	inframe_deletion	2/25	5	NM_018406.7	A2

Frequencies

GnomAD3 genomes AF: 0.0477 AC: 6327 AN: 132510 Hom.: 140 Cov.: 23

Gnomad AFR AF: 0.105

Gnomad AMI AF: 0.0247

Gnomad AMR AF: 0.0386

Gnomad ASJ AF: 0.0445

Gnomad EAS AF: 0.00184

Gnomad SAS AF: 0.00639

Gnomad FIN AF: 0.00743

Gnomad MID AF: 0.0317

Gnomad NFE AF: 0.0343

Gnomad OTH AF: 0.0554

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0155 AC: 21029 AN: 1353204 Hom.: 411 AF XY: 0.0155 AC XY: 10379 AN XY: 668224

Gnomad4 AFR exome AF: 0.0761

Gnomad4 AMR exome AF: 0.0251

Gnomad4 ASJ exome AF: 0.0266

Gnomad4 EAS exome AF: 0.00253

Gnomad4 SAS exome AF: 0.00574

Gnomad4 FIN exome AF: 0.00883

Gnomad4 NFE exome AF: 0.0144

Gnomad4 OTH exome AF: 0.0226

GnomAD4 genome AF: 0.0478 AC: 6335 AN: 132592 Hom.: 141 Cov.: 23 AF XY: 0.0453 AC XY: 2943 AN XY: 64950

Gnomad4 AFR AF: 0.105

Gnomad4 AMR AF: 0.0386

Gnomad4 ASJ AF: 0.0445

Gnomad4 EAS AF: 0.00184

Gnomad4 SAS AF: 0.00618

Gnomad4 FIN AF: 0.00743

Gnomad4 NFE AF: 0.0344

Gnomad4 OTH AF: 0.0548

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Hepatocellular carcinoma Pathogenic:1

Pathogenic, no assertion criteria provided

research

Arun Kumar Laboratory, Indian Institute of Science

Jun 15, 2021

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1560296615; hg19: chr3-195506006;