chr3-195779151-C-CGTGGTGTCACCTGTTGATACTGAGGAAAGGCTGGTGACAGGAAGAGGGGTGGCCTGACCTGTGGATGCCGAGGAAGCGTCGGTGACAGGAAGAGGG

Position:

• chr3-195779151-C-CGTGGTGTCACCTGTTGATACTGAGGAAAGGCTGGTGACAGGAAGAGGGGTGGCCTGACCTGTGGATGCCGAGGAAGCGTCGGTGACAGGAAGAGGG

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM1 PM4

The NM_018406.7(MUC4):​c.12428_12429insCCCTCTTCCTGTCACCGACGCTTCCTCGGCATCCACAGGTCAGGCCACCCCTCTTCCTGTCACCAGCCTTTCCTCAGTATCAACAGGTGACACCAC​(p.Thr4148_Ile4149insAspAlaSerSerAlaSerThrGlyGlnAlaThrProLeuProValThrSerLeuSerSerValSerThrGlyAspThrThrProLeuProValThr) variant causes a inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000115 in 69,690 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00011 (0 hom., cov: 23)
  • Exomes 𝑓: 0.000070 (5 hom.)
  • Failed GnomAD Quality Control
• Consequence: MUC4 NM_018406.7 inframe_insertion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: -0.515

Genes affected

MUC4 (HGNC:7514): (mucin 4, cell surface associated) The major constituents of mucus, the viscous secretion that covers epithelial surfaces such as those in the trachea, colon, and cervix, are highly glycosylated proteins called mucins. These glycoproteins play important roles in the protection of the epithelial cells and have been implicated in epithelial renewal and differentiation. This gene encodes an integral membrane glycoprotein found on the cell surface, although secreted isoforms may exist. At least two dozen transcript variants of this gene have been found, although for many of them the full-length transcript has not been determined or they are found only in tumor tissues. This gene contains a region in the coding sequence which has a variable number (>100) of 48 nt tandem repeats. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM1: In a glycosylation_site O-linked (GalNAc...) threonine (size 0) in uniprot entity MUC4_HUMAN
• PM4: Nonframeshift variant in NON repetitive region in NM_018406.7.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
MUC4	NM_018406.7	c.12428_12429insCCCTCTTCCTGTCACCGACGCTTCCTCGGCATCCACAGGTCAGGCCACCCCTCTTCCTGTCACCAGCCTTTCCTCAGTATCAACAGGTGACACCAC	p.Thr4148_Ile4149insAspAlaSerSerAlaSerThrGlyGlnAlaThrProLeuProValThrSerLeuSerSerValSerThrGlyAspThrThrProLeuProValThr	inframe_insertion	2/25	ENST00000463781.8
MUC4	NM_004532.6	c.83-697_83-696insCCCTCTTCCTGTCACCGACGCTTCCTCGGCATCCACAGGTCAGGCCACCCCTCTTCCTGTCACCAGCCTTTCCTCAGTATCAACAGGTGACACCAC		intron_variant
MUC4	NM_138297.5	c.83-4847_83-4846insCCCTCTTCCTGTCACCGACGCTTCCTCGGCATCCACAGGTCAGGCCACCCCTCTTCCTGTCACCAGCCTTTCCTCAGTATCAACAGGTGACACCAC		intron_variant

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
MUC4	ENST00000463781.8	c.12428_12429insCCCTCTTCCTGTCACCGACGCTTCCTCGGCATCCACAGGTCAGGCCACCCCTCTTCCTGTCACCAGCCTTTCCTCAGTATCAACAGGTGACACCAC	p.Thr4148_Ile4149insAspAlaSerSerAlaSerThrGlyGlnAlaThrProLeuProValThrSerLeuSerSerValSerThrGlyAspThrThrProLeuProValThr	inframe_insertion	2/25	5	NM_018406.7	A2

Frequencies

GnomAD3 genomes AF: 0.000115 AC: 8 AN: 69690 Hom.: 0 Cov.: 23

Gnomad AFR AF: 0.000242

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000145

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000171

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000841

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.000132 AC: 15 AN: 113902 Hom.: 1 AF XY: 0.000131 AC XY: 8 AN XY: 60932

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.000121

Gnomad ASJ exome AF: 0.000426

Gnomad EAS exome AF: 0.000886

Gnomad SAS exome AF: 0.000112

Gnomad FIN exome AF: 0.0000613

Gnomad NFE exome AF: 0.0000674

Gnomad OTH exome AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000702 AC: 84 AN: 1196822 Hom.: 5 Cov.: 147 AF XY: 0.0000678 AC XY: 40 AN XY: 590038

Gnomad4 AFR exome AF: 0.000167

Gnomad4 AMR exome AF: 0.0000754

Gnomad4 ASJ exome AF: 0.000583

Gnomad4 EAS exome AF: 0.000473

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.000135

Gnomad4 NFE exome AF: 0.0000427

Gnomad4 OTH exome AF: 0.000126

GnomAD4 genome AF: 0.000115 AC: 8 AN: 69690 Hom.: 0 Cov.: 23 AF XY: 0.0000579 AC XY: 2 AN XY: 34560

Gnomad4 AFR AF: 0.000242

Gnomad4 AMR AF: 0.000145

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.000171

Gnomad4 NFE AF: 0.0000841

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Lung cancer Pathogenic:1

Pathogenic, no assertion criteria provided

research

Arun Kumar Laboratory, Indian Institute of Science

Jun 15, 2021

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1560296723; hg19: chr3-195506022;