chr3-97768092-A-ATATTTGAATCACATTATGGGATTGC

Variant names:

• chr3-97768092-A-ATATTTGAATCACATTATGGGATTGC
• rs1417632293
• NM_001278293.3:c.-13_12dupTTTGAATCACATTATGGGATTGCTA

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_001278293.3(ARL6):​c.-13_12dupTTTGAATCACATTATGGGATTGCTA​(p.Asp5fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000205 in 1,460,296 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000021 (0 hom.)
• Consequence: ARL6 NM_001278293.3 frameshift
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.0950
• Publications: 0 publications found

Genes affected

ARL6 (HGNC:13210): (ADP ribosylation factor like GTPase 6) The protein encoded by this gene belongs to the ARF-like (ADP ribosylation factor-like) sub-family of the ARF family of GTP-binding proteins which are involved in regulation of intracellular traffic. Mutations in this gene are associated with Bardet-Biedl syndrome (BBS). A vision-specific transcript, encoding long isoform BBS3L, has been described (PMID: 20333246). [provided by RefSeq, Apr 2016]

ARL6 Gene-Disease associations (from GenCC):

• Bardet-Biedl syndrome 3

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), G2P
• ciliopathy

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• retinitis pigmentosa 55

  Inheritance: AR Classification: STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
• retinitis pigmentosa

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Bardet-Biedl syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 37 pathogenic variants in the truncated region.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001278293.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ARL6	NM_001278293.3	MANE Select	c.-13_12dupTTTGAATCACATTATGGGATTGCTA	p.Asp5fs	frameshift	Exon 2 of 8	NP_001265222.1	Q9H0F7-1
	ARL6	NM_001323513.2		c.-13_12dupTTTGAATCACATTATGGGATTGCTA	p.Asp5fs	frameshift	Exon 2 of 9	NP_001310442.1	Q9H0F7-2
	ARL6	NM_032146.5		c.-13_12dupTTTGAATCACATTATGGGATTGCTA	p.Asp5fs	frameshift	Exon 3 of 9	NP_115522.1	Q9H0F7-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ARL6	ENST00000463745.6	TSL:2 MANE Select	c.-13_12dupTTTGAATCACATTATGGGATTGCTA	p.Asp5fs	frameshift	Exon 2 of 8	ENSP00000419619.1	Q9H0F7-1
	ARL6	ENST00000493990.5	TSL:1	n.-13_12dupTTTGAATCACATTATGGGATTGCTA		non_coding_transcript_exon	Exon 3 of 10	ENSP00000418057.1	Q9H0F7-1
	ARL6	ENST00000496713.1	TSL:1	n.226_250dupTTTGAATCACATTATGGGATTGCTA		non_coding_transcript_exon	Exon 2 of 7

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD2 exomes AF: 0.00000398 AC: 1 AN: 251110 AF XY: 0.00000737

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000881

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000205 AC: 3 AN: 1460296 Hom.: 0 Cov.: 31 AF XY: 0.00000138 AC XY: 1 AN XY: 726456

African (AFR) AF: 0.00 AC: 0 AN: 33442

American (AMR) AF: 0.00 AC: 0 AN: 44702

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26086

East Asian (EAS) AF: 0.00 AC: 0 AN: 39600

South Asian (SAS) AF: 0.00 AC: 0 AN: 86200

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53338

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5764

European-Non Finnish (NFE) AF: 0.00000270 AC: 3 AN: 1110846

Other (OTH) AF: 0.00 AC: 0 AN: 60318

GnomAD4 genome Cov.: 32

Alfa AF: 0.000111 Hom.: 0

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Bardet-Biedl syndrome 3;C2936862:Bardet-Biedl syndrome 1;C3150808:Retinitis pigmentosa 55 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.095

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1417632293; hg19: chr3-97486936;