chr4-3074876-C-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant names:

• chr4-3074876-C-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
• rs71180116
• NM_001388492.1:c.78_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. The variant received -9 ACMG points: 0P and 9B. BP3 BS1 BS2

The NM_001388492.1(HTT):​c.78_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln27_Gln37dup) variant causes a disruptive inframe insertion change. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0029 (3 hom., cov: 0)
  • Exomes 𝑓: 0.0011 (13 hom.)
  • Failed GnomAD Quality Control
• Consequence: HTT NM_001388492.1 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 4.84
• Publications: 6 publications found

Genes affected

HTT (HGNC:4851): (huntingtin) Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]

HTT Gene-Disease associations (from GenCC):

• Huntington disease

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), Orphanet
• Lopes-Maciel-Rodan syndrome

  Inheritance: AR Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• juvenile Huntington disease

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -9 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001388492.1
• BS1: Variant frequency is greater than expected in population amr. GnomAd4 allele frequency = 0.00294 (388/131882) while in subpopulation AMR AF = 0.00358 (48/13410). AF 95% confidence interval is 0.00314. There are 3 homozygotes in GnomAd4. There are 180 alleles in the male GnomAd4 subpopulation. Median coverage is 0. This position passed quality control check.
• BS2: High Homozygotes in GnomAd4 at 3 AR,AD gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HTT	NM_001388492.1	c.78_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln27_Gln37dup	disruptive_inframe_insertion	Exon 1 of 67	ENST00000355072.11	NP_001375421.1
HTT	NM_002111.8	c.78_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln27_Gln37dup	disruptive_inframe_insertion	Exon 1 of 67		NP_002102.4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HTT	ENST00000355072.11	c.78_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln27_Gln37dup	disruptive_inframe_insertion	Exon 1 of 67	1	NM_001388492.1	ENSP00000347184.5

Frequencies

GnomAD3 genomes AF: 0.00294 AC: 388 AN: 131784 Hom.: 3 Cov.: 0

Gnomad AFR AF: 0.00248

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00358

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000967

Gnomad SAS AF: 0.00179

Gnomad FIN AF: 0.00244

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00353

Gnomad OTH AF: 0.00334

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00111 AC: 1358 AN: 1225804 Hom.: 13 Cov.: 0 AF XY: 0.00116 AC XY: 708 AN XY: 608106

African (AFR) AF: 0.000930 AC: 24 AN: 25814

American (AMR) AF: 0.00185 AC: 56 AN: 30302

Ashkenazi Jewish (ASJ) AF: 0.000748 AC: 17 AN: 22736

East Asian (EAS) AF: 0.000619 AC: 18 AN: 29096

South Asian (SAS) AF: 0.00168 AC: 121 AN: 72220

European-Finnish (FIN) AF: 0.00145 AC: 47 AN: 32500

Middle Eastern (MID) AF: 0.00238 AC: 9 AN: 3784

European-Non Finnish (NFE) AF: 0.00103 AC: 984 AN: 957516

Other (OTH) AF: 0.00158 AC: 82 AN: 51836

GnomAD4 genome AF: 0.00294 AC: 388 AN: 131882 Hom.: 3 Cov.: 0 AF XY: 0.00284 AC XY: 180 AN XY: 63424

African (AFR) AF: 0.00251 AC: 89 AN: 35524

American (AMR) AF: 0.00358 AC: 48 AN: 13410

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3190

East Asian (EAS) AF: 0.000970 AC: 4 AN: 4124

South Asian (SAS) AF: 0.00153 AC: 6 AN: 3910

European-Finnish (FIN) AF: 0.00244 AC: 18 AN: 7368

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 252

European-Non Finnish (NFE) AF: 0.00353 AC: 217 AN: 61488

Other (OTH) AF: 0.00330 AC: 6 AN: 1816

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.8
Mutation Taster		=80/20	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs71180116; hg19: chr4-3076603;