chr4-3074876-C-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
Variant summary
Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3BS1
The ENST00000355072.11(HTT):c.69_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA(p.Gln24_Gln37dup) variant causes a disruptive inframe insertion change. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
ENST00000355072.11 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- Huntington diseaseInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), Orphanet
- Lopes-Maciel-Rodan syndromeInheritance: AR Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
- juvenile Huntington diseaseInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -5 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: ENST00000355072.11. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| HTT | NM_001388492.1 | MANE Select | c.69_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln24_Gln37dup | disruptive_inframe_insertion | Exon 1 of 67 | NP_001375421.1 | ||
| HTT | NM_002111.8 | c.69_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln24_Gln37dup | disruptive_inframe_insertion | Exon 1 of 67 | NP_002102.4 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| HTT | ENST00000355072.11 | TSL:1 MANE Select | c.69_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln24_Gln37dup | disruptive_inframe_insertion | Exon 1 of 67 | ENSP00000347184.5 | ||
| HTT | ENST00000680291.1 | n.214_255dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon | Exon 1 of 41 | |||||
| HTT | ENST00000681528.1 | c.6-12045_6-12004dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | intron | N/A | ENSP00000506116.1 |
Frequencies
GnomAD3 genomes AF: 0.000842 AC: 111AN: 131784Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000339 AC: 416AN: 1225840Hom.: 7 Cov.: 0 AF XY: 0.000340 AC XY: 207AN XY: 608134 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000849 AC: 112AN: 131882Hom.: 0 Cov.: 0 AF XY: 0.000914 AC XY: 58AN XY: 63424 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at