chr4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-C
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_001388492.1(HTT):c.72_110delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA(p.Gln25_Gln37del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000155 in 1,225,878 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_001388492.1 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Huntington diseaseInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae)
- Lopes-Maciel-Rodan syndromeInheritance: AR Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
- juvenile Huntington diseaseInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001388492.1. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| HTT | MANE Select | c.72_110delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln25_Gln37del | disruptive_inframe_deletion | Exon 1 of 67 | NP_001375421.1 | P42858 | ||
| HTT | c.72_110delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln25_Gln37del | disruptive_inframe_deletion | Exon 1 of 67 | NP_002102.4 | P42858 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| HTT | TSL:1 MANE Select | c.72_110delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln25_Gln37del | disruptive_inframe_deletion | Exon 1 of 67 | ENSP00000347184.5 | P42858 | ||
| HTT | c.6-12042_6-12004delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | intron | N/A | ENSP00000506116.1 | A0A7P0TAC5 | ||||
| HTT | c.6-12042_6-12004delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | intron | N/A | ENSP00000506029.1 | A0A7P0TA78 |
Frequencies
GnomAD3 genomes AF: 0.00 AC: 0AN: 131784Hom.: 0 Cov.: 0
GnomAD4 exome AF: 0.0000155 AC: 19AN: 1225878Hom.: 0 AF XY: 0.0000148 AC XY: 9AN XY: 608158 show subpopulations
Age Distribution
GnomAD4 genome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0AN: 131784Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0AN XY: 63314
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.