chr4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-C

Variant names:

• chr4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-C
• rs71180116
• NM_001388492.1:c.72_110delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_001388492.1(HTT):​c.72_110delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln25_Gln37del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000155 in 1,225,878 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000015 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: HTT NM_001388492.1 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 5.65
• Publications: 0 publications found

Genes affected

HTT (HGNC:4851): (huntingtin) Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]

HTT Gene-Disease associations (from GenCC):

• Huntington disease

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), Orphanet
• Lopes-Maciel-Rodan syndrome

  Inheritance: AR Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• juvenile Huntington disease

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001388492.1

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HTT	NM_001388492.1	c.72_110delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln25_Gln37del	disruptive_inframe_deletion	Exon 1 of 67	ENST00000355072.11	NP_001375421.1
HTT	NM_002111.8	c.72_110delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln25_Gln37del	disruptive_inframe_deletion	Exon 1 of 67		NP_002102.4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HTT	ENST00000355072.11	c.72_110delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln25_Gln37del	disruptive_inframe_deletion	Exon 1 of 67	1	NM_001388492.1	ENSP00000347184.5

Frequencies

GnomAD3 genomes AF: 0.00 AC: 0 AN: 131784 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000155 AC: 19 AN: 1225878 Hom.: 0 AF XY: 0.0000148 AC XY: 9 AN XY: 608158

African (AFR) AF: 0.00 AC: 0 AN: 25814

American (AMR) AF: 0.00 AC: 0 AN: 30306

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 22736

East Asian (EAS) AF: 0.00 AC: 0 AN: 29096

South Asian (SAS) AF: 0.0000277 AC: 2 AN: 72234

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 32500

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3784

European-Non Finnish (NFE) AF: 0.0000178 AC: 17 AN: 957570

Other (OTH) AF: 0.00 AC: 0 AN: 51838

GnomAD4 genome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0 AN: 131784 Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0 AN XY: 63314

African (AFR) AF: 0.00 AC: 0 AN: 35416

American (AMR) AF: 0.00 AC: 0 AN: 13398

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3190

East Asian (EAS) AF: 0.00 AC: 0 AN: 4136

South Asian (SAS) AF: 0.00 AC: 0 AN: 3912

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 7368

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 268

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 61500

Other (OTH) AF: 0.00 AC: 0 AN: 1796

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.7
Mutation Taster		=106/94	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs71180116; hg19: chr4-3076603;