chr4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-C

Variant names:

• chr4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-C
• NM_001388492.1:c.66_110delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Uncertain significance. Variant got 1 ACMG points: 2P and 1B. PM2 BP3

The NM_001388492.1(HTT):​c.66_110delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln23_Gln37del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00000163 in 1,225,884 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 0)
  • Exomes 𝑓: 0.0000016 (0 hom.)
• Consequence: HTT NM_001388492.1 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 5.65

Genes affected

HTT (HGNC:4851): (huntingtin) Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 1 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP3: Nonframeshift variant in repetitive region in NM_001388492.1

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HTT	NM_001388492.1	c.66_110delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln23_Gln37del	disruptive_inframe_deletion	Exon 1 of 67	ENST00000355072.11	NP_001375421.1
HTT	NM_002111.8	c.66_110delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln23_Gln37del	disruptive_inframe_deletion	Exon 1 of 67		NP_002102.4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HTT	ENST00000355072.11	c.66_110delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln23_Gln37del	disruptive_inframe_deletion	Exon 1 of 67	1	NM_001388492.1	ENSP00000347184.5

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD4 exome AF: 0.00000163 AC: 2 AN: 1225884 Hom.: 0 AF XY: 0.00000164 AC XY: 1 AN XY: 608162

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.0000308

Gnomad4 NFE exome AF: 0.00000104

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr4-3076603;