chr4-41746002-C-CGCTGCCGCGGCCGCCGCCGCT
Variant summary
Our verdict is Uncertain significance. The variant received 1 ACMG points: 2P and 1B. PP5_ModerateBP3
The NM_003924.4(PHOX2B):c.729_749dupAGCGGCGGCGGCCGCGGCAGC(p.Ala244_Ala250dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. A250A) has been classified as Likely benign.
Frequency
Consequence
NM_003924.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- central hypoventilation syndrome, congenital, 1, with or without Hirschsprung diseaseInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen, G2P
- Haddad syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- neuroblastoma, susceptibility to, 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P
- congenital central hypoventilation syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_003924.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PHOX2B | NM_003924.4 | MANE Select | c.729_749dupAGCGGCGGCGGCCGCGGCAGC | p.Ala244_Ala250dup | disruptive_inframe_insertion | Exon 3 of 3 | NP_003915.2 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PHOX2B | ENST00000226382.4 | TSL:1 MANE Select | c.729_749dupAGCGGCGGCGGCCGCGGCAGC | p.Ala244_Ala250dup | disruptive_inframe_insertion | Exon 3 of 3 | ENSP00000226382.2 | ||
| PHOX2B | ENST00000510424.2 | TSL:3 | n.*10_*30dupAGCGGCGGCGGCCGCGGCAGC | downstream_gene | N/A |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Data not reliable, filtered out with message: AC0;AS_VQSR AF: 0.00 AC: 0AN: 1015758Hom.: 0 Cov.: 30 AF XY: 0.00 AC XY: 0AN XY: 484012
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Central hypoventilation syndrome, congenital, 1, with or without Hirschsprung disease Pathogenic:1
Congenital central hypoventilation Pathogenic:1
The p.Ala241[27] variant in PHOX2B is a well-established pathogenic variant for CCHS, which has been reported in >200 affected individuals across multiple studi es (Weese-Mayer 2010). This variant is a 21bp duplication within a polyalanine t ract in exon 3 of the PHOX2B gene, resulting in an expansion to a total of 27 al anine residues. It frequently occurs de novo, though autosomal dominant inherita nce and somatic mosaicism have also been reported. In summary, this variant meet s our criteria to be classified as pathogenic for CCHS in an autosomal dominant manner.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at