chr4-5711341-G-GGCGGCGGGATGCGGCGGGGCGGCAGCCTGAGCGCCCCGGATGGCCC

Position:

• chr4-5711341-G-GGCGGCGGGATGCGGCGGGGCGGCAGCCTGAGCGCCCCGGATGGCCC

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_153717.3(EVC):​c.-31_15dupATGCGGCGGGGCGGCAGCCTGAGCGCCCCGGATGGCCCGCGGCGGG​(p.Ala6fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000132 in 151,256 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000058 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: EVC NM_153717.3 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: -0.0390

Genes affected

EVC (HGNC:3497): (EvC ciliary complex subunit 1) This gene encodes a protein containing a leucine zipper and a transmembrane domain. This gene has been implicated in both Ellis-van Creveld syndrome (EvC) and Weyers acrodental dysostosis. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 20 pathogenic variants in the truncated region.
• PP5: Variant 4-5711341-G-GGCGGCGGGATGCGGCGGGGCGGCAGCCTGAGCGCCCCGGATGGCCC is Pathogenic according to our data. Variant chr4-5711341-G-GGCGGCGGGATGCGGCGGGGCGGCAGCCTGAGCGCCCCGGATGGCCC is described in ClinVar as [Likely_pathogenic]. Clinvar id is 3590623.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
EVC	NM_153717.3	c.-31_15dupATGCGGCGGGGCGGCAGCCTGAGCGCCCCGGATGGCCCGCGGCGGG	p.Ala6fs	frameshift_variant	1/21	ENST00000264956.11	NP_714928.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
EVC	ENST00000264956.11	c.-31_15dupATGCGGCGGGGCGGCAGCCTGAGCGCCCCGGATGGCCCGCGGCGGG	p.Ala6fs	frameshift_variant	1/21	1	NM_153717.3	ENSP00000264956.6
EVC	ENST00000509451.1	c.-31_15dupATGCGGCGGGGCGGCAGCCTGAGCGCCCCGGATGGCCCGCGGCGGG	p.Ala6fs	frameshift_variant	1/12	1		ENSP00000426774.1

Frequencies

GnomAD3 genomes AF: 0.0000132 AC: 2 AN: 151148 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000414

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000584 AC: 5 AN: 856636 Hom.: 0 Cov.: 27 AF XY: 0.0000126 AC XY: 5 AN XY: 398240

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.000291

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.0000132 AC: 2 AN: 151256 Hom.: 0 Cov.: 32 AF XY: 0.0000135 AC XY: 1 AN XY: 73954

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000414

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Ellis-van Creveld syndrome;C0457013:Curry-Hall syndrome Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Fulgent Genetics, Fulgent Genetics

May 14, 2024

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr4-5713068;