chr5-112828986-CATTTAGTACTATAATATGAATTTCATGTTTGGCTTTTTTTTGCTGCCTTCTTTTAGCCATGAGATTTCCTAATTTCTTACCTGTGTATT-C
Variant summary
Our verdict is Benign. Variant got -12 ACMG points: 0P and 12B. BP6_Very_StrongBS2
The NM_000038.6(APC):c.1743+18_1743+106delTAGTACTATAATATGAATTTCATGTTTGGCTTTTTTTTGCTGCCTTCTTTTAGCCATGAGATTTCCTAATTTCTTACCTGTGTATTATT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000201 in 1,539,288 control chromosomes in the GnomAD database, including 1 homozygotes. Variant has been reported in ClinVar as Likely benign (★★).
Frequency
Consequence
NM_000038.6 intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Benign. Variant got -12 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
APC | ENST00000257430.9 | c.1743+18_1743+106delTAGTACTATAATATGAATTTCATGTTTGGCTTTTTTTTGCTGCCTTCTTTTAGCCATGAGATTTCCTAATTTCTTACCTGTGTATTATT | intron_variant | Intron 14 of 15 | 5 | NM_000038.6 | ENSP00000257430.4 | |||
ENSG00000258864 | ENST00000520401.1 | n.228+18_228+106delTAGTACTATAATATGAATTTCATGTTTGGCTTTTTTTTGCTGCCTTCTTTTAGCCATGAGATTTCCTAATTTCTTACCTGTGTATTATT | intron_variant | Intron 3 of 7 | 3 | ENSP00000454861.1 |
Frequencies
GnomAD3 genomes AF: 0.0000263 AC: 4AN: 152088Hom.: 0 Cov.: 32
GnomAD4 exome AF: 0.0000195 AC: 27AN: 1387082Hom.: 1 AF XY: 0.0000173 AC XY: 12AN XY: 694442
GnomAD4 genome AF: 0.0000263 AC: 4AN: 152206Hom.: 0 Cov.: 32 AF XY: 0.0000403 AC XY: 3AN XY: 74418
ClinVar
Submissions by phenotype
not specified Benign:1
This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease. -
Familial adenomatous polyposis 1 Benign:1
- -
Hereditary cancer-predisposing syndrome Benign:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at