chr5-146878727-AGCTGCTGCTGCTGCTGCTGCT-A
Variant summary
Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BS2
The NM_181675.4(PPP2R2B):c.-282_-262delAGCAGCAGCAGCAGCAGCAGC variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000462 in 1,297,488 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_181675.4 5_prime_UTR
Scores
Clinical Significance
Conservation
Publications
- spinocerebellar ataxia type 12Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_181675.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PPP2R2B | MANE Select | c.-282_-262delAGCAGCAGCAGCAGCAGCAGC | 5_prime_UTR | Exon 1 of 10 | NP_858061.3 | Q00005-1 | |||
| PPP2R2B | c.-677_-657delAGCAGCAGCAGCAGCAGCAGC | 5_prime_UTR | Exon 1 of 9 | NP_001415206.1 | Q00005-1 | ||||
| PPP2R2B | c.-172_-152delAGCAGCAGCAGCAGCAGCAGC | 5_prime_UTR | Exon 1 of 10 | NP_001415208.1 | Q00005-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PPP2R2B | TSL:2 MANE Select | c.-282_-262delAGCAGCAGCAGCAGCAGCAGC | 5_prime_UTR | Exon 1 of 10 | ENSP00000377933.3 | Q00005-1 | |||
| PPP2R2B | TSL:1 | c.-795_-775delAGCAGCAGCAGCAGCAGCAGC | 5_prime_UTR | Exon 1 of 10 | ENSP00000398779.2 | Q00005-6 | |||
| PPP2R2B | TSL:1 | c.75-553_75-533delAGCAGCAGCAGCAGCAGCAGC | intron | N/A | ENSP00000377936.1 | Q00005-5 |
Frequencies
GnomAD3 genomes AF: 0.00000665 AC: 1AN: 150488Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.00000436 AC: 5AN: 1147000Hom.: 0 AF XY: 0.00000712 AC XY: 4AN XY: 562108 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00000665 AC: 1AN: 150488Hom.: 0 Cov.: 0 AF XY: 0.0000136 AC XY: 1AN XY: 73346 show subpopulations
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at