chr5-61332333-G-GGCGGCGGCGGCGGGGGCAGCA
Variant summary
Our verdict is Uncertain significance. Variant got 0 ACMG points: 2P and 2B. PM2BP6_Moderate
The NM_020928.2(ZSWIM6):c.75_95dupGGGCAGCAGCGGCGGCGGCGG(p.Gly32_Gly33insGlySerSerGlyGlyGlyGly) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000755 in 132,364 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely benign (★).
Frequency
Consequence
NM_020928.2 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 0 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
ZSWIM6 | NM_020928.2 | c.75_95dupGGGCAGCAGCGGCGGCGGCGG | p.Gly32_Gly33insGlySerSerGlyGlyGlyGly | disruptive_inframe_insertion | Exon 1 of 14 | ENST00000252744.6 | NP_065979.1 | |
LOC105378994 | XR_007058781.1 | n.-138_-118dupTGCTGCCCCCGCCGCCGCCGC | upstream_gene_variant |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.00000755 AC: 1AN: 132364Hom.: 0 Cov.: 31
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000542 AC: 5AN: 923030Hom.: 0 Cov.: 28 AF XY: 0.00000229 AC XY: 1AN XY: 435746
GnomAD4 genome AF: 0.00000755 AC: 1AN: 132364Hom.: 0 Cov.: 31 AF XY: 0.00 AC XY: 0AN XY: 64110
ClinVar
Submissions by phenotype
Inborn genetic diseases Benign:1
This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at