chr5-61332333-GGCGGCGGCGGCGGGGGCAGCA-G
Variant summary
Our verdict is Benign. Variant got -12 ACMG points: 0P and 12B. BP6_Very_StrongBS2
The NM_020928.2(ZSWIM6):c.75_95delGGGCAGCAGCGGCGGCGGCGG(p.Gly26_Gly32del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000105 in 1,055,464 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely benign (★★).
Frequency
Consequence
NM_020928.2 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Benign. Variant got -12 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
ZSWIM6 | NM_020928.2 | c.75_95delGGGCAGCAGCGGCGGCGGCGG | p.Gly26_Gly32del | disruptive_inframe_deletion | Exon 1 of 14 | ENST00000252744.6 | NP_065979.1 | |
LOC105378994 | XR_007058781.1 | n.-138_-118delTGCTGCCCCCGCCGCCGCCGC | upstream_gene_variant |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.000446 AC: 59AN: 132364Hom.: 0 Cov.: 31
GnomAD4 exome AF: 0.0000563 AC: 52AN: 923030Hom.: 0 AF XY: 0.0000666 AC XY: 29AN XY: 435746
GnomAD4 genome AF: 0.000446 AC: 59AN: 132434Hom.: 0 Cov.: 31 AF XY: 0.000530 AC XY: 34AN XY: 64188
ClinVar
Submissions by phenotype
Inborn genetic diseases Benign:1
This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -
not provided Benign:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at