chr5-83142292-G-GGATGAGGAAACTAACTCTCAGTGGTGTTTA

Variant names:

• chr5-83142292-G-GGATGAGGAAACTAACTCTCAGTGGTGTTTA
• rs28360071
• NM_003401.5:c.315+31120_315+31149dupGATGAGGAAACTAACTCTCAGTGGTGTTTA

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_003401.5(XRCC4):​c.315+31120_315+31149dupGATGAGGAAACTAACTCTCAGTGGTGTTTA variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 0)
• Consequence: XRCC4 NM_003401.5 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.964
• Publications: 0 publications found

Genes affected

XRCC4 (HGNC:12831): (X-ray repair cross complementing 4) The protein encoded by this gene functions together with DNA ligase IV and the DNA-dependent protein kinase in the repair of DNA double-strand breaks. This protein plays a role in both non-homologous end joining and the completion of V(D)J recombination. Mutations in this gene can cause short stature, microcephaly, and endocrine dysfunction (SSMED). Alternate transcript variants such as NM_022406 are unlikely to be expressed in some individuals due to a polymorphism (rs1805377) in the last splice acceptor site. [provided by RefSeq, Oct 2019]

XRCC4 Gene-Disease associations (from GenCC):

• short stature, microcephaly, and endocrine dysfunction

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Laboratory for Molecular Medicine
• microcephalic primordial dwarfism-insulin resistance syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• hereditary nonpolyposis colon cancer

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
XRCC4	NM_003401.5	c.315+31120_315+31149dupGATGAGGAAACTAACTCTCAGTGGTGTTTA		intron_variant	Intron 3 of 7	ENST00000396027.9	NP_003392.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
XRCC4	ENST00000396027.9	c.315+31089_315+31090insGATGAGGAAACTAACTCTCAGTGGTGTTTA		intron_variant	Intron 3 of 7	5	NM_003401.5	ENSP00000379344.4

Frequencies

GnomAD3 genomes Cov.: 0

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.96

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs28360071; hg19: chr5-82438111;