chr6-109691433-G-GCCATGCCCACGGCCGCCGCCC

Variant names:

• chr6-109691433-G-GCCATGCCCACGGCCGCCGCCC
• rs1462234190
• NM_014845.6:c.3_23dupGCCCACGGCCGCCGCCCCCAT

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_014845.6(FIG4):​c.3_23dupGCCCACGGCCGCCGCCCCCAT​(p.Met1_Pro7dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000317 in 1,576,012 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000021 (0 hom.)
• Consequence: FIG4 NM_014845.6 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: -0.254
• Publications: 0 publications found

Genes affected

FIG4 (HGNC:16873): (FIG4 phosphoinositide 5-phosphatase) The protein encoded by this gene belongs to the SAC domain-containing protein gene family. The SAC domain, approximately 400 amino acids in length and consisting of seven conserved motifs, has been shown to possess phosphoinositide phosphatase activity. The yeast homolog, Sac1p, is involved in the regulation of various phosphoinositides, and affects diverse cellular functions such as actin cytoskeleton organization, Golgi function, and maintenance of vacuole morphology. Membrane-bound phosphoinositides function as signaling molecules and play a key role in vesicle trafficking in eukaryotic cells. Mutations in this gene have been associated with Charcot-Marie-Tooth disease, type 4J. [provided by RefSeq, Jul 2008]

AK9 (HGNC:33814): (adenylate kinase 9) The protein encoded by this gene catalyzes the interconversion of nucleosides, possessing both nucleoside monophosphate and diphosphate kinase activities. The encoded protein uses these interconversions to maintain nucleoside homeostasis. [provided by RefSeq, Jul 2016]

AK9 Gene-Disease associations (from GenCC):

• postsynaptic congenital myasthenic syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_014845.6.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_014845.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FIG4	NM_014845.6	MANE Select	c.3_23dupGCCCACGGCCGCCGCCCCCAT	p.Met1_Pro7dup	disruptive_inframe_insertion	Exon 1 of 23	NP_055660.1	Q92562
	AK9	NM_001145128.3	MANE Select	c.-319_-299dupGGGCGGCGGCCGTGGGCATGG		upstream_gene	N/A	NP_001138600.2	Q5TCS8-4
	AK9	NM_001329603.2		c.-995_-975dupGGGCGGCGGCCGTGGGCATGG		upstream_gene	N/A	NP_001316532.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FIG4	ENST00000230124.8	TSL:1 MANE Select	c.3_23dupGCCCACGGCCGCCGCCCCCAT	p.Met1_Pro7dup	disruptive_inframe_insertion	Exon 1 of 23	ENSP00000230124.4	Q92562
	FIG4	ENST00000674884.1		c.3_23dupGCCCACGGCCGCCGCCCCCAT	p.Met1_Pro7dup	disruptive_inframe_insertion	Exon 1 of 23	ENSP00000502668.1	A0A6Q8PHH5
	FIG4	ENST00000674744.1		c.3_23dupGCCCACGGCCGCCGCCCCCAT	p.Met1_Pro7dup	disruptive_inframe_insertion	Exon 1 of 23	ENSP00000501661.1	A0A6Q8PF62

Frequencies

GnomAD3 genomes AF: 0.0000131 AC: 2 AN: 152094 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000294

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000211 AC: 3 AN: 1423918 Hom.: 0 Cov.: 31 AF XY: 0.00000142 AC XY: 1 AN XY: 704934

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 32606

American (AMR) AF: 0.00 AC: 0 AN: 39610

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25454

East Asian (EAS) AF: 0.00 AC: 0 AN: 37574

South Asian (SAS) AF: 0.00 AC: 0 AN: 81210

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 50200

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5720

European-Non Finnish (NFE) AF: 0.00000183 AC: 2 AN: 1092702

Other (OTH) AF: 0.0000170 AC: 1 AN: 58842

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.0556734), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000131 AC: 2 AN: 152094 Hom.: 0 Cov.: 32 AF XY: 0.0000269 AC XY: 2 AN XY: 74296

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 41404

American (AMR) AF: 0.00 AC: 0 AN: 15274

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3466

East Asian (EAS) AF: 0.00 AC: 0 AN: 5170

South Asian (SAS) AF: 0.00 AC: 0 AN: 4832

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10606

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000294 AC: 2 AN: 68022

Other (OTH) AF: 0.00 AC: 0 AN: 2092

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0.00000000770867), which strongly suggests a high chance of mosaicism in these individuals.

Alfa AF: 0.00 Hom.: 0

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Charcot-Marie-Tooth disease type 4 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.25

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1462234190; hg19: chr6-110012636;