chr6-118559048-T-TTGCTGATCTGTATCATCGTGA

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM1PM2PM4

The NM_002667.5(PLN):​c.132_152dupGATCTGTATCATCGTGATGCT​(p.Leu51_Leu52insIleCysIleIleValMetLeu) variant causes a disruptive inframe insertion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).

Frequency

Genomes: not found (cov: 32)

Consequence

PLN
NM_002667.5 disruptive_inframe_insertion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, multiple submitters, no conflicts U:2

Conservation

PhyloP100: 6.64
Variant links:
Genes affected
PLN (HGNC:9080): (phospholamban) The protein encoded by this gene is found as a pentamer and is a major substrate for the cAMP-dependent protein kinase in cardiac muscle. The encoded protein is an inhibitor of cardiac muscle sarcoplasmic reticulum Ca(2+)-ATPase in the unphosphorylated state, but inhibition is relieved upon phosphorylation of the protein. The subsequent activation of the Ca(2+) pump leads to enhanced muscle relaxation rates, thereby contributing to the inotropic response elicited in heart by beta-agonists. The encoded protein is a key regulator of cardiac diastolic function. Mutations in this gene are a cause of inherited human dilated cardiomyopathy with refractory congestive heart failure, and also familial hypertrophic cardiomyopathy. [provided by RefSeq, Apr 2016]
CEP85L (HGNC:21638): (centrosomal protein 85 like) The protein encoded by this gene was identified as a breast cancer antigen. Nothing more is known of its function at this time. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

PM1
In a chain Cardiac phospholamban (size 51) in uniprot entity PPLA_HUMAN there are 6 pathogenic changes around while only 0 benign (100%) in NM_002667.5
PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_002667.5.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
PLNNM_002667.5 linkc.132_152dupGATCTGTATCATCGTGATGCT p.Leu51_Leu52insIleCysIleIleValMetLeu disruptive_inframe_insertion Exon 2 of 2 ENST00000357525.6 NP_002658.1 P26678Q5R352
CEP85LNM_001042475.3 linkc.1020+6460_1020+6480dupTCACGATGATACAGATCAGCA intron_variant Intron 3 of 12 ENST00000368491.8 NP_001035940.1 Q5SZL2-1Q3ZCQ5

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
PLNENST00000357525.6 linkc.132_152dupGATCTGTATCATCGTGATGCT p.Leu51_Leu52insIleCysIleIleValMetLeu disruptive_inframe_insertion Exon 2 of 2 1 NM_002667.5 ENSP00000350132.5 P26678
CEP85LENST00000368491.8 linkc.1020+6460_1020+6480dupTCACGATGATACAGATCAGCA intron_variant Intron 3 of 12 1 NM_001042475.3 ENSP00000357477.3 Q5SZL2-1

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
28
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Dilated cardiomyopathy 1P Uncertain:1
Mar 22, 2023
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This variant, c.132_152dup, results in the insertion of 7 amino acid(s) of the PLN protein (p.Ile45_Leu51dup), but otherwise preserves the integrity of the reading frame. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 464268). This variant has not been reported in the literature in individuals affected with PLN-related conditions. This variant is not present in population databases (gnomAD no frequency). -

not provided Uncertain:1
Jan 21, 2020
GeneDx
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

Has not been previously published as pathogenic or benign to our knowledge; Not observed in large population cohorts (Lek et al., 2016); In-frame insertion of seven amino acids in a non-repeat region -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1554219865; hg19: chr6-118880211; API