chr6-170561958-A-ACAGCAGCAGCAGCAGCAGCAG
Variant summary
Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP3BS2_Supporting
The ENST00000392092.7(TBP):c.261_281dupGCAGCAGCAGCAGCAGCAGCA(p.Gln88_Gln94dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000391 in 1,405,074 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
ENST00000392092.7 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- spinocerebellar ataxia type 17Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, Orphanet, Ambry Genetics, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: ENST00000392092.7. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TBP | NM_003194.5 | MANE Select | c.261_281dupGCAGCAGCAGCAGCAGCAGCA | p.Gln88_Gln94dup | disruptive_inframe_insertion | Exon 3 of 8 | NP_003185.1 | ||
| TBP | NM_001172085.2 | c.201_221dupGCAGCAGCAGCAGCAGCAGCA | p.Gln68_Gln74dup | disruptive_inframe_insertion | Exon 2 of 7 | NP_001165556.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TBP | ENST00000392092.7 | TSL:1 MANE Select | c.261_281dupGCAGCAGCAGCAGCAGCAGCA | p.Gln88_Gln94dup | disruptive_inframe_insertion | Exon 3 of 8 | ENSP00000375942.2 | ||
| TBP | ENST00000230354.10 | TSL:1 | c.261_281dupGCAGCAGCAGCAGCAGCAGCA | p.Gln88_Gln94dup | disruptive_inframe_insertion | Exon 3 of 8 | ENSP00000230354.5 | ||
| TBP | ENST00000421512.5 | TSL:1 | c.261_281dupGCAGCAGCAGCAGCAGCAGCA | p.Gln88_Gln94dup | disruptive_inframe_insertion | Exon 3 of 5 | ENSP00000400008.1 |
Frequencies
GnomAD3 genomes AF: 0.000105 AC: 15AN: 143372Hom.: 0 Cov.: 24 show subpopulations
GnomAD4 exome AF: 0.0000317 AC: 40AN: 1261702Hom.: 0 Cov.: 0 AF XY: 0.0000301 AC XY: 19AN XY: 630696 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000105 AC: 15AN: 143372Hom.: 0 Cov.: 24 AF XY: 0.000143 AC XY: 10AN XY: 69954 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at