chr6-7571496-G-GCGGAAAATACAGTCTCAGTTCACCGATGCC

Variant names:

• chr6-7571496-G-GCGGAAAATACAGTCTCAGTTCACCGATGCC
• rs606231293
• NM_004415.4:c.1817_1846dupGGAAAATACAGTCTCAGTTCACCGATGCCC

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1 PM4 PP5

The NM_004415.4(DSP):​c.1817_1846dupGGAAAATACAGTCTCAGTTCACCGATGCCC​(p.Arg606_Ala615dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. Q616Q) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: DSP NM_004415.4 disruptive_inframe_insertion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 1.91
• Publications: 0 publications found

Genes affected

DSP (HGNC:3052): (desmoplakin) This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]

DSP Gene-Disease associations (from GenCC):

• keratosis palmoplantaris striata 2

  Inheritance: AD Classification: DEFINITIVE, STRONG, LIMITED Submitted by: Genomics England PanelApp, Ambry Genetics, G2P
• arrhythmogenic cardiomyopathy with wooly hair and keratoderma

  Inheritance: AR, AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Genomics England PanelApp, Ambry Genetics, Labcorp Genetics (formerly Invitae), Orphanet, G2P, ClinGen
• arrhythmogenic right ventricular dysplasia 8

  Inheritance: AR, AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
• skin fragility-woolly hair-palmoplantar keratoderma syndrome

  Inheritance: AR, AD Classification: DEFINITIVE, STRONG, SUPPORTIVE, LIMITED Submitted by: Genomics England PanelApp, G2P, Ambry Genetics, Orphanet
• cardiomyopathy, dilated, with wooly hair, keratoderma, and tooth agenesis

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics
• dilated cardiomyopathy

  Inheritance: AD Classification: STRONG Submitted by: ClinGen
• lethal acantholytic epidermolysis bullosa

  Inheritance: AR Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet
• familial isolated dilated cardiomyopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• striate palmoplantar keratoderma

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• severe dermatitis-multiple allergies-metabolic wasting syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• hypertrophic cardiomyopathy

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

• PM1: In a hotspot region, there are 2 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 2 benign, 11 uncertain in NM_004415.4
• PM4: Nonframeshift variant in NON repetitive region in NM_004415.4.
• PP5: Variant 6-7571496-G-GCGGAAAATACAGTCTCAGTTCACCGATGCC is Pathogenic according to our data. Variant chr6-7571496-G-GCGGAAAATACAGTCTCAGTTCACCGATGCC is described in ClinVar as Pathogenic. ClinVar VariationId is 157671.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004415.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DSP	NM_004415.4	MANE Select	c.1817_1846dupGGAAAATACAGTCTCAGTTCACCGATGCCC	p.Arg606_Ala615dup	disruptive_inframe_insertion	Exon 14 of 24	NP_004406.2	P15924-1
	DSP	NM_001319034.2		c.1817_1846dupGGAAAATACAGTCTCAGTTCACCGATGCCC	p.Arg606_Ala615dup	disruptive_inframe_insertion	Exon 14 of 24	NP_001305963.1	P15924-3
	DSP	NM_001008844.3		c.1817_1846dupGGAAAATACAGTCTCAGTTCACCGATGCCC	p.Arg606_Ala615dup	disruptive_inframe_insertion	Exon 14 of 24	NP_001008844.1	P15924-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DSP	ENST00000379802.8	TSL:1 MANE Select	c.1817_1846dupGGAAAATACAGTCTCAGTTCACCGATGCCC	p.Arg606_Ala615dup	disruptive_inframe_insertion	Exon 14 of 24	ENSP00000369129.3	P15924-1
	DSP	ENST00000418664.3	TSL:1	c.1817_1846dupGGAAAATACAGTCTCAGTTCACCGATGCCC	p.Arg606_Ala615dup	disruptive_inframe_insertion	Exon 14 of 24	ENSP00000396591.2	P15924-2
	DSP	ENST00000713904.1		c.1691_1720dupGGAAAATACAGTCTCAGTTCACCGATGCCC	p.Arg564_Ala573dup	disruptive_inframe_insertion	Exon 14 of 24	ENSP00000519203.1	A0AAQ5BH40

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Cardiomyopathy, dilated, with wooly hair, keratoderma, and tooth agenesis (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.9
Mutation Taster		=65/35	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs606231293; hg19: chr6-7571729;