chr6-80106670-TGAGAATCCCGGTGGTGAGCGGGGATG-T

Variant names:

• chr6-80106670-TGAGAATCCCGGTGGTGAGCGGGGATG-T
• rs1582146275
• NM_183050.4:c.-22_4delAGAATCCCGGTGGTGAGCGGGGATGG

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_001318975.1(BCKDHB):​c.-26_-15+14delAGAATCCCGGTGGTGAGCGGGGATGG variant causes a splice donor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: BCKDHB NM_001318975.1 splice_donor, splice_region, 5_prime_UTR, intron
• Clinical Significance: Likely pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 0.885
• Publications: 0 publications found

Genes affected

BCKDHB (HGNC:987): (branched chain keto acid dehydrogenase E1 subunit beta) This gene encodes the E1 beta subunit of branched-chain keto acid dehydrogenase, which is a multienzyme complex associated with the inner membrane of mitochondria. This enzyme complex functions in the catabolism of branched-chain amino acids. Mutations in this gene have been associated with maple syrup urine disease (MSUD), type 1B, a disease characterized by a maple syrup odor to the urine in addition to mental and physical retardation and feeding problems. Alternative splicing at this locus results in multiple transcript variants. [provided by RefSeq, Jan 2016]

BCKDHB Gene-Disease associations (from GenCC):

• maple syrup urine disease type 1B

  Inheritance: AR Classification: DEFINITIVE Submitted by: G2P, Myriad Women’s Health, ClinGen
• maple syrup urine disease

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• classic maple syrup urine disease

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• intermediate maple syrup urine disease

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• intermittent maple syrup urine disease

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• thiamine-responsive maple syrup urine disease

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
• PP5: Variant 6-80106670-TGAGAATCCCGGTGGTGAGCGGGGATG-T is Pathogenic according to our data. Variant chr6-80106670-TGAGAATCCCGGTGGTGAGCGGGGATG-T is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 558247.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001318975.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BCKDHB	NM_183050.4	MANE Select	c.-22_4delAGAATCCCGGTGGTGAGCGGGGATGG	p.Met1fs	frameshift start_lost	Exon 1 of 10	NP_898871.1	P21953-1
	BCKDHB	NM_183050.4	MANE Select	c.-22_4delAGAATCCCGGTGGTGAGCGGGGATGG		5_prime_UTR	Exon 1 of 10	NP_898871.1	P21953-1
	BCKDHB	NM_001424035.1		c.-22_4delAGAATCCCGGTGGTGAGCGGGGATGG	p.Met1fs	frameshift start_lost	Exon 1 of 10	NP_001410964.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BCKDHB	ENST00000320393.9	TSL:1 MANE Select	c.-22_4delAGAATCCCGGTGGTGAGCGGGGATGG	p.Met1fs	frameshift start_lost	Exon 1 of 10	ENSP00000318351.5	P21953-1
	BCKDHB	ENST00000356489.9	TSL:1	c.-22_4delAGAATCCCGGTGGTGAGCGGGGATGG	p.Met1fs	frameshift start_lost	Exon 1 of 11	ENSP00000348880.5	P21953-1
	BCKDHB	ENST00000320393.9	TSL:1 MANE Select	c.-22_4delAGAATCCCGGTGGTGAGCGGGGATGG		5_prime_UTR	Exon 1 of 10	ENSP00000318351.5	P21953-1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Likely pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Maple syrup urine disease (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.89

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1582146275; hg19: chr6-80816387;