chr6-80106670-TGAGAATCCCGGTGGTGAGCGGGGATG-T

Position:

• chr6-80106670-TGAGAATCCCGGTGGTGAGCGGGGATG-T

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_001318975.1(BCKDHB):​c.-26_-15+14delAGAATCCCGGTGGTGAGCGGGGATGG variant causes a splice donor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: BCKDHB NM_001318975.1 splice_donor, splice_region, 5_prime_UTR, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 0.885

Genes affected

BCKDHB (HGNC:987): (branched chain keto acid dehydrogenase E1 subunit beta) This gene encodes the E1 beta subunit of branched-chain keto acid dehydrogenase, which is a multienzyme complex associated with the inner membrane of mitochondria. This enzyme complex functions in the catabolism of branched-chain amino acids. Mutations in this gene have been associated with maple syrup urine disease (MSUD), type 1B, a disease characterized by a maple syrup odor to the urine in addition to mental and physical retardation and feeding problems. Alternative splicing at this locus results in multiple transcript variants. [provided by RefSeq, Jan 2016]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 6-80106670-TGAGAATCCCGGTGGTGAGCGGGGATG-T is Pathogenic according to our data. Variant chr6-80106670-TGAGAATCCCGGTGGTGAGCGGGGATG-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 558247.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
BCKDHB	NM_183050.4	c.-22_4delAGAATCCCGGTGGTGAGCGGGGATGG	p.Met1fs	frameshift_variant, start_lost	1/10	ENST00000320393.9	NP_898871.1
BCKDHB	NM_183050.4	c.-22_4delAGAATCCCGGTGGTGAGCGGGGATGG		5_prime_UTR_variant	1/10	ENST00000320393.9	NP_898871.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
BCKDHB	ENST00000320393.9	c.-22_4delAGAATCCCGGTGGTGAGCGGGGATGG	p.Met1fs	frameshift_variant, start_lost	1/10	1	NM_183050.4	ENSP00000318351.5
BCKDHB	ENST00000320393	c.-22_4delAGAATCCCGGTGGTGAGCGGGGATGG		5_prime_UTR_variant	1/10	1	NM_183050.4	ENSP00000318351.5

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Maple syrup urine disease Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Counsyl

May 08, 2018

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1582146275; hg19: chr6-80816387;