chr7-100676163-CCTGCATCCCCCAGGCCTCGGGCCAGCGGCCAGGAG-C

Variant names:

• chr7-100676163-CCTGCATCCCCCAGGCCTCGGGCCAGCGGCCAGGAG-C
• NM_005273.4:c.-89-9_-64delATCCCCCAGGCCTCGGGCCAGCGGCCAGGAGCTGC

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_Strong PM2

The NM_005273.4(GNB2):​c.-89-9_-64delATCCCCCAGGCCTCGGGCCAGCGGCCAGGAGCTGC variant causes a splice acceptor, splice region, 5 prime UTR, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: GNB2 NM_005273.4 splice_acceptor, splice_region, 5_prime_UTR, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 3.78

Genes affected

GNB2 (HGNC:4398): (G protein subunit beta 2) Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. This gene contains a trinucleotide (CCG) repeat length polymorphism in its 5' UTR. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.1427175 fraction of the gene. Cryptic splice site detected, with MaxEntScore 6.6, offset of 0 (no position change), new splice context is: gtcagccctgcctcccccAGccc. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in frameshift change.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
GNB2	NM_005273.4	c.-89-9_-64delATCCCCCAGGCCTCGGGCCAGCGGCCAGGAGCTGC		splice_region_variant	Exon 2 of 10	ENST00000303210.9	NP_005264.2
GNB2	NM_005273.4	c.-89-9_-64delATCCCCCAGGCCTCGGGCCAGCGGCCAGGAGCTGC		splice_acceptor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant	Exon 2 of 10	ENST00000303210.9	NP_005264.2
GNB2	NM_005273.4	c.-89-9_-64delATCCCCCAGGCCTCGGGCCAGCGGCCAGGAGCTGC		non_coding_transcript_variant		ENST00000303210.9	NP_005264.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
GNB2	ENST00000303210.9	c.-89-9_-64delATCCCCCAGGCCTCGGGCCAGCGGCCAGGAGCTGC		splice_region_variant	Exon 2 of 10	1	NM_005273.4	ENSP00000305260.4
GNB2	ENST00000303210	c.-89-9_-64delATCCCCCAGGCCTCGGGCCAGCGGCCAGGAGCTGC		splice_acceptor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant	Exon 2 of 10	1	NM_005273.4	ENSP00000305260.4
GNB2	ENST00000303210.9	c.-89-9_-64delATCCCCCAGGCCTCGGGCCAGCGGCCAGGAGCTGC		non_coding_transcript_variant		1	NM_005273.4	ENSP00000305260.4

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Jan 31, 2024

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Has not been previously published as pathogenic or benign to our knowledge; Canonical splice site variant in a gene for which loss-of-function is not a known mechanism of disease -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr7-100273786;