chr7-100676163-CCTGCATCCCCCAGGCCTCGGGCCAGCGGCCAGGAG-C

Variant names:

• chr7-100676163-CCTGCATCCCCCAGGCCTCGGGCCAGCGGCCAGGAG-C
• NM_005273.4:c.-89-9_-64delATCCCCCAGGCCTCGGGCCAGCGGCCAGGAGCTGC

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_Strong

The NM_005273.4(GNB2):​c.-89-9_-64delATCCCCCAGGCCTCGGGCCAGCGGCCAGGAGCTGC variant causes a splice acceptor, splice region, 5 prime UTR, intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: GNB2 NM_005273.4 splice_acceptor, splice_region, 5_prime_UTR, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 3.78
• Publications: 0 publications found

Genes affected

GNB2 (HGNC:4398): (G protein subunit beta 2) Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. This gene contains a trinucleotide (CCG) repeat length polymorphism in its 5' UTR. [provided by RefSeq, Jul 2008]

GNB2 Gene-Disease associations (from GenCC):

• neurodevelopmental disorder with hypotonia and dysmorphic facies

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• sick sinus syndrome 4

  Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.1427175 fraction of the gene. Cryptic splice site detected, with MaxEntScore 6.6, offset of 0 (no position change), new splice context is: gtcagccctgcctcccccAGccc. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in frameshift change.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_005273.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GNB2	NM_005273.4	MANE Select	c.-89-9_-64delATCCCCCAGGCCTCGGGCCAGCGGCCAGGAGCTGC		splice_region	Exon 2 of 10	NP_005264.2
	GNB2	NM_005273.4	MANE Select	c.-89-9_-64delATCCCCCAGGCCTCGGGCCAGCGGCCAGGAGCTGC		splice_acceptor splice_region 5_prime_UTR intron	Exon 2 of 10	NP_005264.2
	GNB2	NM_005273.4	MANE Select	c.-89-9_-64delATCCCCCAGGCCTCGGGCCAGCGGCCAGGAGCTGC		non_coding_transcript	N/A	NP_005264.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GNB2	ENST00000303210.9	TSL:1 MANE Select	c.-89-9_-64delATCCCCCAGGCCTCGGGCCAGCGGCCAGGAGCTGC		splice_region	Exon 2 of 10	ENSP00000305260.4	P62879-1
	GNB2	ENST00000393924.1	TSL:1	c.-98_-64delATCCCCCAGGCCTCGGGCCAGCGGCCAGGAGCTGC		5_prime_UTR	Exon 1 of 9	ENSP00000377501.1	P62879-1
	GNB2	ENST00000303210.9	TSL:1 MANE Select	c.-89-9_-64delATCCCCCAGGCCTCGGGCCAGCGGCCAGGAGCTGC		splice_acceptor splice_region 5_prime_UTR intron	Exon 2 of 10	ENSP00000305260.4	P62879-1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.8

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr7-100273786;