chr7-37909611-A-ACTTACTATGGATCTTTTACTAAGCTGATCTCTCCATTTTTCAAC
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_003014.4(SFRP4):c.817_855+5dupGTTGAAAAATGGAGAGATCAGCTTAGTAAAAGATCCATAGTAAG variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000456 in 1,534,502 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_003014.4 splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- Pyle diseaseInheritance: AR Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, PanelApp Australia, Ambry Genetics, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_003014.4. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SFRP4 | TSL:1 MANE Select | c.855+5_855+6insGTTGAAAAATGGAGAGATCAGCTTAGTAAAAGATCCATAGTAAG | splice_region intron | N/A | ENSP00000410715.2 | Q6FHJ7 | |||
| ENSG00000290149 | TSL:4 | c.-37-39229_-37-39228insCTTACTATGGATCTTTTACTAAGCTGATCTCTCCATTTTTCAAC | intron | N/A | ENSP00000425858.1 | D6RIH7 | |||
| SFRP4 | c.855+5_855+6insGTTGAAAAATGGAGAGATCAGCTTAGTAAAAGATCCATAGTAAG | splice_region intron | N/A | ENSP00000630743.1 |
Frequencies
GnomAD3 genomes AF: 0.0000263 AC: 4AN: 152164Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.00000447 AC: 1AN: 223622 AF XY: 0.00 show subpopulations
GnomAD4 exome AF: 0.00000217 AC: 3AN: 1382338Hom.: 0 Cov.: 22 AF XY: 0.00000145 AC XY: 1AN XY: 688800 show subpopulations
GnomAD4 genome AF: 0.0000263 AC: 4AN: 152164Hom.: 0 Cov.: 32 AF XY: 0.0000135 AC XY: 1AN XY: 74334 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at