chr7-50319067-TGCTGATGAGGGTCAAGACATGTCCCAAGTTTCAGGTGAGACCTTATGAGATAGCTGTGTGGGAAGTTCATGAGAAAA-T

Variant names:

• chr7-50319067-TGCTGATGAGGGTCAAGACATGTCCCAAGTTTCAGGTGAGACCTTATGAGATAGCTGTGTGGGAAGTTCATGAGAAAA-T
• NM_006060.6:c.10_40+46delGATGAGGGTCAAGACATGTCCCAAGTTTCAGGTGAGACCTTATGAGATAGCTGTGTGGGAAGTTCATGAGAAAAGCT

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_006060.6(IKZF1):​c.10_40+46delGATGAGGGTCAAGACATGTCCCAAGTTTCAGGTGAGACCTTATGAGATAGCTGTGTGGGAAGTTCATGAGAAAAGCT​(p.Asp4fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: IKZF1 NM_006060.6 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 8.67
• Publications: 0 publications found

Genes affected

IKZF1 (HGNC:13176): (IKAROS family zinc finger 1) This gene encodes a transcription factor that belongs to the family of zinc-finger DNA-binding proteins associated with chromatin remodeling. The expression of this protein is restricted to the fetal and adult hemo-lymphopoietic system, and it functions as a regulator of lymphocyte differentiation. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. Most isoforms share a common C-terminal domain, which contains two zinc finger motifs that are required for hetero- or homo-dimerization, and for interactions with other proteins. The isoforms, however, differ in the number of N-terminal zinc finger motifs that bind DNA and in nuclear localization signal presence, resulting in members with and without DNA-binding properties. Only a few isoforms contain the requisite three or more N-terminal zinc motifs that confer high affinity binding to a specific core DNA sequence element in the promoters of target genes. The non-DNA-binding isoforms are largely found in the cytoplasm, and are thought to function as dominant-negative factors. Overexpression of some dominant-negative isoforms have been associated with B-cell malignancies, such as acute lymphoblastic leukemia (ALL). [provided by RefSeq, May 2014]

IKZF1 Gene-Disease associations (from GenCC):

• pancytopenia due to IKZF1 mutations

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Illumina, Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), Orphanet
• autoimmune disease

  Inheritance: AD Classification: MODERATE Submitted by: ClinGen

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 33 pathogenic variants in the truncated region.
• PP5: Variant 7-50319067-TGCTGATGAGGGTCAAGACATGTCCCAAGTTTCAGGTGAGACCTTATGAGATAGCTGTGTGGGAAGTTCATGAGAAAA-T is Pathogenic according to our data. Variant chr7-50319067-TGCTGATGAGGGTCAAGACATGTCCCAAGTTTCAGGTGAGACCTTATGAGATAGCTGTGTGGGAAGTTCATGAGAAAA-T is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 3779761.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_006060.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	IKZF1	NM_006060.6	MANE Select	c.10_40+46delGATGAGGGTCAAGACATGTCCCAAGTTTCAGGTGAGACCTTATGAGATAGCTGTGTGGGAAGTTCATGAGAAAAGCT	p.Asp4fs	frameshift splice_donor splice_region intron	Exon 2 of 8	NP_006051.1	Q13422-1
	IKZF1	NM_001410879.1		c.10_40+46delGATGAGGGTCAAGACATGTCCCAAGTTTCAGGTGAGACCTTATGAGATAGCTGTGTGGGAAGTTCATGAGAAAAGCT	p.Asp4fs	frameshift splice_donor splice_region intron	Exon 2 of 9	NP_001397808.1	A0A8V8TNQ0
	IKZF1	NM_001220765.3		c.10_40+46delGATGAGGGTCAAGACATGTCCCAAGTTTCAGGTGAGACCTTATGAGATAGCTGTGTGGGAAGTTCATGAGAAAAGCT	p.Asp4fs	frameshift splice_donor splice_region intron	Exon 2 of 7	NP_001207694.1	Q13422-7

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	IKZF1	ENST00000331340.8	TSL:1 MANE Select	c.7_40+43delGCTGATGAGGGTCAAGACATGTCCCAAGTTTCAGGTGAGACCTTATGAGATAGCTGTGTGGGAAGTTCATGAGAAAA	p.Ala3fs	frameshift splice_donor splice_region intron	Exon 2 of 8	ENSP00000331614.3	Q13422-1
	IKZF1	ENST00000359197.9	TSL:1	c.7_40+43delGCTGATGAGGGTCAAGACATGTCCCAAGTTTCAGGTGAGACCTTATGAGATAGCTGTGTGGGAAGTTCATGAGAAAA	p.Ala3fs	frameshift splice_donor splice_region intron	Exon 2 of 7	ENSP00000352123.5	Q13422-7
	IKZF1	ENST00000439701.2	TSL:1	c.7_40+43delGCTGATGAGGGTCAAGACATGTCCCAAGTTTCAGGTGAGACCTTATGAGATAGCTGTGTGGGAAGTTCATGAGAAAA	p.Ala3fs	frameshift splice_donor splice_region intron	Exon 2 of 7	ENSP00000413025.1	Q13422-7

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Pancytopenia due to IKZF1 mutations (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.7

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr7-50358663;