chr7-50319067-TGCTGATGAGGGTCAAGACATGTCCCAAGTTTCAGGTGAGACCTTATGAGATAGCTGTGTGGGAAGTTCATGAGAAAA-T

Variant names:

• chr7-50319067-TGCTGATGAGGGTCAAGACATGTCCCAAGTTTCAGGTGAGACCTTATGAGATAGCTGTGTGGGAAGTTCATGAGAAAA-T
• NM_006060.6:c.10_40+46delGATGAGGGTCAAGACATGTCCCAAGTTTCAGGTGAGACCTTATGAGATAGCTGTGTGGGAAGTTCATGAGAAAAGCT

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_006060.6(IKZF1):​c.10_40+46delGATGAGGGTCAAGACATGTCCCAAGTTTCAGGTGAGACCTTATGAGATAGCTGTGTGGGAAGTTCATGAGAAAAGCT​(p.Asp4fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: IKZF1 NM_006060.6 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 8.67

Genes affected

IKZF1 (HGNC:13176): (IKAROS family zinc finger 1) This gene encodes a transcription factor that belongs to the family of zinc-finger DNA-binding proteins associated with chromatin remodeling. The expression of this protein is restricted to the fetal and adult hemo-lymphopoietic system, and it functions as a regulator of lymphocyte differentiation. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. Most isoforms share a common C-terminal domain, which contains two zinc finger motifs that are required for hetero- or homo-dimerization, and for interactions with other proteins. The isoforms, however, differ in the number of N-terminal zinc finger motifs that bind DNA and in nuclear localization signal presence, resulting in members with and without DNA-binding properties. Only a few isoforms contain the requisite three or more N-terminal zinc motifs that confer high affinity binding to a specific core DNA sequence element in the promoters of target genes. The non-DNA-binding isoforms are largely found in the cytoplasm, and are thought to function as dominant-negative factors. Overexpression of some dominant-negative isoforms have been associated with B-cell malignancies, such as acute lymphoblastic leukemia (ALL). [provided by RefSeq, May 2014]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 27 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 7-50319067-TGCTGATGAGGGTCAAGACATGTCCCAAGTTTCAGGTGAGACCTTATGAGATAGCTGTGTGGGAAGTTCATGAGAAAA-T is Pathogenic according to our data. Variant chr7-50319067-TGCTGATGAGGGTCAAGACATGTCCCAAGTTTCAGGTGAGACCTTATGAGATAGCTGTGTGGGAAGTTCATGAGAAAA-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 3779761.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
IKZF1	NM_006060.6	c.10_40+46delGATGAGGGTCAAGACATGTCCCAAGTTTCAGGTGAGACCTTATGAGATAGCTGTGTGGGAAGTTCATGAGAAAAGCT	p.Asp4fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 2 of 8	ENST00000331340.8	NP_006051.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
IKZF1	ENST00000331340.8	c.7_40+43delGCTGATGAGGGTCAAGACATGTCCCAAGTTTCAGGTGAGACCTTATGAGATAGCTGTGTGGGAAGTTCATGAGAAAA	p.Ala3fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 2 of 8	1	NM_006060.6	ENSP00000331614.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Pancytopenia due to IKZF1 mutations Pathogenic:1

Jan 04, 2023

Department of Pathology and Laboratory Medicine, Sinai Health System

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: research

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr7-50358663;