chr7-73331695-A-AGTGGCAGCTACGGAACGGGAGT
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_003602.5(FKBP6):c.508_529dupGTGGCAGCTACGGAACGGGAGT(p.Phe177CysfsTer20) variant causes a frameshift change. The variant allele was found at a frequency of 0.00023 in 1,613,900 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_003602.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- spermatogenic failure 77Inheritance: AR Classification: MODERATE Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_003602.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| FKBP6 | MANE Select | c.508_529dupGTGGCAGCTACGGAACGGGAGT | p.Phe177CysfsTer20 | frameshift | Exon 5 of 9 | NP_003593.3 | |||
| FKBP6 | c.493_514dupGTGGCAGCTACGGAACGGGAGT | p.Phe172CysfsTer20 | frameshift | Exon 5 of 9 | NP_001128683.1 | O75344-2 | |||
| FKBP6 | c.418_439dupGTGGCAGCTACGGAACGGGAGT | p.Phe147CysfsTer20 | frameshift | Exon 4 of 8 | NP_001268233.1 | O75344-3 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| FKBP6 | TSL:1 MANE Select | c.508_529dupGTGGCAGCTACGGAACGGGAGT | p.Phe177CysfsTer20 | frameshift | Exon 5 of 9 | ENSP00000252037.4 | O75344-1 | ||
| FKBP6 | TSL:1 | n.508_529dupGTGGCAGCTACGGAACGGGAGT | non_coding_transcript_exon | Exon 5 of 8 | ENSP00000403908.1 | F8WD36 | |||
| FKBP6 | TSL:2 | c.493_514dupGTGGCAGCTACGGAACGGGAGT | p.Phe172CysfsTer20 | frameshift | Exon 5 of 9 | ENSP00000416277.2 | O75344-2 |
Frequencies
GnomAD3 genomes AF: 0.000191 AC: 29AN: 152156Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.000148 AC: 37AN: 249588 AF XY: 0.000148 show subpopulations
GnomAD4 exome AF: 0.000234 AC: 342AN: 1461744Hom.: 0 Cov.: 31 AF XY: 0.000232 AC XY: 169AN XY: 727184 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000191 AC: 29AN: 152156Hom.: 0 Cov.: 32 AF XY: 0.000175 AC XY: 13AN XY: 74336 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at