chr7-74059892-TTCCTGGTGTCGGCGTGGCTCCTGGAGTTGGCGTGGC-T
Variant summary
Our verdict is Likely benign. Variant got -2 ACMG points: 2P and 4B. PM4BS2
The NM_000501.4(ELN):c.1434_1469delCGTGGCTCCTGGAGTTGGCGTGGCTCCTGGTGTCGG(p.Val479_Gly490del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000778 in 1,285,968 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. G478G) has been classified as Likely benign.
Frequency
Consequence
NM_000501.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_benign. Variant got -2 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes AF: 0.0000132 AC: 2AN: 152084Hom.: 0 Cov.: 32
GnomAD3 exomes AF: 0.00000795 AC: 2AN: 251460Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 135914
GnomAD4 exome AF: 0.00000706 AC: 8AN: 1133884Hom.: 0 AF XY: 0.00000518 AC XY: 3AN XY: 579494
GnomAD4 genome AF: 0.0000132 AC: 2AN: 152084Hom.: 0 Cov.: 32 AF XY: 0.0000135 AC XY: 1AN XY: 74292
ClinVar
Submissions by phenotype
Supravalvar aortic stenosis Uncertain:1
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant has not been reported in the literature in individuals affected with ELN-related conditions. This variant is present in population databases (no rsID available, gnomAD 0.003%). This variant, c.1521_1556del, results in the deletion of 12 amino acid(s) of the ELN protein (p.Val514_Gly525del), but otherwise preserves the integrity of the reading frame. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at