chr8-143929466-GGCAGCCGCAGGCGGTGCACGGTGCGCGTCTCACAGGCCTCCAGCT-G

Variant names:

• chr8-143929466-GGCAGCCGCAGGCGGTGCACGGTGCGCGTCTCACAGGCCTCCAGCT-G
• rs1554710983
• NM_201384.3:c.2984_3028delAGCTGGAGGCCTGTGAGACGCGCACCGTGCACCGCCTGCGGCTGC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_201384.3(PLEC):​c.2984_3028delAGCTGGAGGCCTGTGAGACGCGCACCGTGCACCGCCTGCGGCTGC​(p.Gln995_Leu1009del) variant causes a disruptive inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: PLEC NM_201384.3 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 5.37
• Publications: 0 publications found

Genes affected

PLEC (HGNC:9069): (plectin) Plectin is a prominent member of an important family of structurally and in part functionally related proteins, termed plakins or cytolinkers, that are capable of interlinking different elements of the cytoskeleton. Plakins, with their multi-domain structure and enormous size, not only play crucial roles in maintaining cell and tissue integrity and orchestrating dynamic changes in cytoarchitecture and cell shape, but also serve as scaffolding platforms for the assembly, positioning, and regulation of signaling complexes (reviewed in PMID: 9701547, 11854008, and 17499243). Plectin is expressed as several protein isoforms in a wide range of cell types and tissues from a single gene located on chromosome 8 in humans (PMID: 8633055, 8698233). Until 2010, this locus was named plectin 1 (symbol PLEC1 in human; Plec1 in mouse and rat) and the gene product had been referred to as "hemidesmosomal protein 1" or "plectin 1, intermediate filament binding 500kDa". These names were superseded by plectin. The plectin gene locus in mouse on chromosome 15 has been analyzed in detail (PMID: 10556294, 14559777), revealing a genomic exon-intron organization with well over 40 exons spanning over 62 kb and an unusual 5' transcript complexity of plectin isoforms. Eleven exons (1-1j) have been identified that alternatively splice directly into a common exon 2 which is the first exon to encode plectin's highly conserved actin binding domain (ABD). Three additional exons (-1, 0a, and 0) splice into an alternative first coding exon (1c), and two additional exons (2alpha and 3alpha) are optionally spliced within the exons encoding the acting binding domain (exons 2-8). Analysis of the human locus has identified eight of the eleven alternative 5' exons found in mouse and rat (PMID: 14672974); exons 1i, 1j and 1h have not been confirmed in human. Furthermore, isoforms lacking the central rod domain encoded by exon 31 have been detected in mouse (PMID:10556294), rat (PMID: 9177781), and human (PMID: 11441066, 10780662, 20052759). The short alternative amino-terminal sequences encoded by the different first exons direct the targeting of the various isoforms to distinct subcellular locations (PMID: 14559777). As the expression of specific plectin isoforms was found to be dependent on cell type (tissue) and stage of development (PMID: 10556294, 12542521, 17389230) it appears that each cell type (tissue) contains a unique set (proportion and composition) of plectin isoforms, as if custom-made for specific requirements of the particular cells. Concordantly, individual isoforms were found to carry out distinct and specific functions (PMID: 14559777, 12542521, 18541706). In 1996, a number of groups reported that patients suffering from epidermolysis bullosa simplex with muscular dystrophy (EBS-MD) lacked plectin expression in skin and muscle tissues due to defects in the plectin gene (PMID: 8698233, 8941634, 8636409, 8894687, 8696340). Two other subtypes of plectin-related EBS have been described: EBS-pyloric atresia (PA) and EBS-Ogna. For reviews of plectin-related diseases see PMID: 15810881, 19945614. Mutations in the plectin gene related to human diseases should be named based on the position in NM_000445 (variant 1, isoform 1c), unless the mutation is located within one of the other alternative first exons, in which case the position in the respective Reference Sequence should be used. [provided by RefSeq, Aug 2011]

PLEC Gene-Disease associations (from GenCC):

• epidermolysis bullosa simplex

  Inheritance: AD Classification: STRONG Submitted by: G2P
• epidermolysis bullosa simplex 5A, Ogna type

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, PanelApp Australia, Genomics England PanelApp
• autosomal recessive limb-girdle muscular dystrophy type 2Q

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Labcorp Genetics (formerly Invitae)
• congenital myasthenic syndrome

  Inheritance: AR Classification: STRONG Submitted by: Genomics England PanelApp
• epidermolysis bullosa simplex 5B, with muscular dystrophy

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: PanelApp Australia, Orphanet, Genomics England PanelApp
• epidermolysis bullosa simplex 5C, with pyloric atresia

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
• epidermolysis bullosa simplex with nail dystrophy

  Inheritance: AR Classification: STRONG Submitted by: PanelApp Australia
• autosomal recessive limb-girdle muscular dystrophy

  Inheritance: AR Classification: MODERATE Submitted by: ClinGen
• aplasia cutis congenita

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• cholestasis

  Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_201384.3.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PLEC	NM_201384.3	c.2984_3028delAGCTGGAGGCCTGTGAGACGCGCACCGTGCACCGCCTGCGGCTGC	p.Gln995_Leu1009del	disruptive_inframe_deletion	Exon 24 of 32	ENST00000345136.8	NP_958786.1
PLEC	NM_201378.4	c.2942_2986delAGCTGGAGGCCTGTGAGACGCGCACCGTGCACCGCCTGCGGCTGC	p.Gln981_Leu995del	disruptive_inframe_deletion	Exon 24 of 32	ENST00000356346.7	NP_958780.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PLEC	ENST00000345136.8	c.2984_3028delAGCTGGAGGCCTGTGAGACGCGCACCGTGCACCGCCTGCGGCTGC	p.Gln995_Leu1009del	disruptive_inframe_deletion	Exon 24 of 32	1	NM_201384.3	ENSP00000344848.3
PLEC	ENST00000356346.7	c.2942_2986delAGCTGGAGGCCTGTGAGACGCGCACCGTGCACCGCCTGCGGCTGC	p.Gln981_Leu995del	disruptive_inframe_deletion	Exon 24 of 32	1	NM_201378.4	ENSP00000348702.3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Epidermolysis bullosa simplex, Ogna type;C2677349:Epidermolysis bullosa simplex 5C, with pyloric atresia;C2931072:Epidermolysis bullosa simplex 5B, with muscular dystrophy;C3150989:Autosomal recessive limb-girdle muscular dystrophy type 2Q;C4225309:Epidermolysis bullosa simplex with nail dystrophy Uncertain:1

Dec 19, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. This variant has not been reported in the literature in individuals with PLEC-related disease. This variant is not present in population databases (ExAC no frequency). This variant, c.3065_3109del45, results in the deletion of 15 amino acids of the PLEC protein (p.Gln1022_Leu1036del), but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554710983; hg19: chr8-145003634;