chr8-1857879-GATCTATCTATCTATCTATCTATCTATCTATCT-G
Variant summary
Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BS2
The NM_014629.4(ARHGEF10):c.38-64_38-33delATCTATCTATCTATCTATCTATCTATCTATCT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000104 in 480,668 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_014629.4 intron
Scores
Clinical Significance
Conservation
Publications
- autosomal dominant slowed nerve conduction velocityInheritance: Unknown, AD Classification: SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Orphanet
- hereditary peripheral neuropathyInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
- peripheral neuropathyInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_014629.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ARHGEF10 | NM_014629.4 | MANE Select | c.38-64_38-33delATCTATCTATCTATCTATCTATCTATCTATCT | intron | N/A | NP_055444.2 | O15013-5 | ||
| ARHGEF10 | NM_001438091.1 | c.38-64_38-33delATCTATCTATCTATCTATCTATCTATCTATCT | intron | N/A | NP_001425020.1 | ||||
| ARHGEF10 | NM_001308153.3 | c.38-64_38-33delATCTATCTATCTATCTATCTATCTATCTATCT | intron | N/A | NP_001295082.2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ARHGEF10 | ENST00000349830.8 | TSL:1 MANE Select | c.38-80_38-49delATCTATCTATCTATCTATCTATCTATCTATCT | intron | N/A | ENSP00000340297.3 | O15013-5 | ||
| ARHGEF10 | ENST00000518288.5 | TSL:1 | c.110-80_110-49delATCTATCTATCTATCTATCTATCTATCTATCT | intron | N/A | ENSP00000431012.1 | O15013-6 | ||
| ARHGEF10 | ENST00000520359.5 | TSL:1 | c.38-80_38-49delATCTATCTATCTATCTATCTATCTATCTATCT | intron | N/A | ENSP00000427909.1 | O15013-7 |
Frequencies
GnomAD3 genomes Cov.: 24
GnomAD4 exome AF: 0.0000104 AC: 5AN: 480668Hom.: 0 AF XY: 0.00000784 AC XY: 2AN XY: 255064 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 24
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at