chr9-124482935-G-GTCAAGCAGGGCGGCGTTGGCCTTCTCCTGAGCGTCTT

Position:

• chr9-124482935-G-GTCAAGCAGGGCGGCGTTGGCCTTCTCCTGAGCGTCTT

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_004959.5(NR5A1):​c.1172_1208dupAAGACGCTCAGGAGAAGGCCAACGCCGCCCTGCTTGA​(p.Asp403fs) variant causes a frameshift, stop gained change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 30)
• Consequence: NR5A1 NM_004959.5 frameshift, stop_gained
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 7.97

Genes affected

NR5A1 (HGNC:7983): (nuclear receptor subfamily 5 group A member 1) The protein encoded by this gene is a transcriptional activator involved in sex determination. The encoded protein binds DNA as a monomer. Defects in this gene are a cause of XY sex reversal with or without adrenal failure as well as adrenocortical insufficiency without ovarian defect. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.128 CDS is truncated, and there are 3 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 9-124482935-G-GTCAAGCAGGGCGGCGTTGGCCTTCTCCTGAGCGTCTT is Pathogenic according to our data. Variant chr9-124482935-G-GTCAAGCAGGGCGGCGTTGGCCTTCTCCTGAGCGTCTT is described in ClinVar as [Pathogenic]. Clinvar id is 817717.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
NR5A1	NM_004959.5	c.1172_1208dupAAGACGCTCAGGAGAAGGCCAACGCCGCCCTGCTTGA	p.Asp403fs	frameshift_variant, stop_gained	7/7	ENST00000373588.9	NP_004950.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
NR5A1	ENST00000373588.9	c.1172_1208dupAAGACGCTCAGGAGAAGGCCAACGCCGCCCTGCTTGA	p.Asp403fs	frameshift_variant, stop_gained	7/7	1	NM_004959.5	ENSP00000362690.4
NR5A1	ENST00000620110.4	c.1052_1088dupAAGACGCTCAGGAGAAGGCCAACGCCGCCCTGCTTGA	p.Asp363fs	frameshift_variant, stop_gained	6/6	5		ENSP00000483309.1
NR5A1	ENST00000373587.3	c.524_560dupAAGACGCTCAGGAGAAGGCCAACGCCGCCCTGCTTGA	p.Asp187fs	frameshift_variant, stop_gained	5/5	3		ENSP00000362689.3

Frequencies

GnomAD3 genomes Cov.: 30

GnomAD4 exome Cov.: 37

GnomAD4 genome Cov.: 30

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

GeneDx

Jul 04, 2018

The c.1172_1208dup37 variant in the NR5A1 gene has not been reported previously as a pathogenic variant nor as a benign variant, to our knowledge. The c.1172_1208dup37 variant causes a frameshift starting with codon Aspartic Acid 403, changes this amino acid to a Glutamic Acid residue, and creates a premature Stop codon at position 13 of the new reading frame, denoted p.Asp403GlufsX13. This variant is predicted to cause loss of normal protein function through protein truncation. The c.1172_1208dup37 variant is not observed in large population cohorts (Lek et al., 2016). We interpret c.1172_1208dup37 as a pathogenic variant. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1588613754; hg19: chr9-127245214;