chr9-137253370-GATGCACCCTTCTGGCTGGCCAACCCTTCT-G
Variant summary
Our verdict is Benign. The variant received -10 ACMG points: 0P and 10B. BP6_ModerateBS1BS2
The NM_001256699.2(STPG3):c.1072_1100delCACCCTTCTGGCTGGCCAACCCTTCTATG(p.His358GlyfsTer27) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00294 in 1,534,214 control chromosomes in the GnomAD database, including 68 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★).
Frequency
Consequence
NM_001256699.2 frameshift
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001256699.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| STPG3 | MANE Select | c.*129_*157delCACCCTTCTGGCTGGCCAACCCTTCTATG | 3_prime_UTR | Exon 6 of 6 | NP_001004353.2 | Q8N7X2-4 | |||
| STPG3 | c.1072_1100delCACCCTTCTGGCTGGCCAACCCTTCTATG | p.His358GlyfsTer27 | frameshift | Exon 6 of 6 | NP_001243628.1 | Q8N7X2-2 | |||
| STPG3 | c.907_935delCACCCTTCTGGCTGGCCAACCCTTCTATG | p.His303GlyfsTer27 | frameshift | Exon 6 of 6 | NP_001243629.1 | Q8N7X2-3 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| STPG3 | TSL:1 | c.1072_1100delCACCCTTCTGGCTGGCCAACCCTTCTATG | p.His358GlyfsTer27 | frameshift | Exon 6 of 6 | ENSP00000373583.3 | Q8N7X2-2 | ||
| STPG3 | TSL:1 | c.907_935delCACCCTTCTGGCTGGCCAACCCTTCTATG | p.His303GlyfsTer26 | frameshift | Exon 6 of 6 | ENSP00000477998.1 | Q8N7X2-3 | ||
| STPG3 | TSL:1 MANE Select | c.*129_*157delCACCCTTCTGGCTGGCCAACCCTTCTATG | 3_prime_UTR | Exon 6 of 6 | ENSP00000391218.1 | Q8N7X2-4 |
Frequencies
GnomAD3 genomes AF: 0.00376 AC: 572AN: 152128Hom.: 6 Cov.: 33 show subpopulations
GnomAD2 exomes AF: 0.00572 AC: 783AN: 136958 AF XY: 0.00554 show subpopulations
GnomAD4 exome AF: 0.00285 AC: 3937AN: 1381968Hom.: 62 AF XY: 0.00283 AC XY: 1931AN XY: 681384 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00375 AC: 571AN: 152246Hom.: 6 Cov.: 33 AF XY: 0.00463 AC XY: 345AN XY: 74452 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.