chr9-2039776-A-ACAGCAGCAGCAGCAGCAGCAG

Position:

• chr9-2039776-A-ACAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Likely benign. Variant got -6 ACMG points: 2P and 8B. PM2 BS1 BS2

The NM_003070.5(SMARCA2):​c.687_707dupGCAGCAGCAGCAGCAGCAGCA​(p.Gln230_Gln236dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000332 in 150,432 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. Q236Q) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000033 (0 hom., cov: 26)
  • Exomes 𝑓: 0.000018 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: SMARCA2 NM_003070.5 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.00

Genes affected

SMARCA2 (HGNC:11098): (SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2) The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]

SMARCA2 (HGNC:):

ACMG classification

Verdict is Likely_benign. Variant got -6 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BS1: Variant frequency is greater than expected in population nfe. gnomad4 allele frequency = 0.0000332 (5/150432) while in subpopulation NFE AF= 0.0000592 (4/67592). AF 95% confidence interval is 0.0000198. There are 0 homozygotes in gnomad4. There are 3 alleles in male gnomad4 subpopulation. Median coverage is 26. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 5 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
SMARCA2	NM_003070.5	c.687_707dupGCAGCAGCAGCAGCAGCAGCA	p.Gln230_Gln236dup	disruptive_inframe_insertion	4/34	ENST00000349721.8	NP_003061.3
SMARCA2	NM_001289396.1	c.687_707dupGCAGCAGCAGCAGCAGCAGCA	p.Gln230_Gln236dup	disruptive_inframe_insertion	4/34		NP_001276325.1
SMARCA2	NM_139045.4	c.687_707dupGCAGCAGCAGCAGCAGCAGCA	p.Gln230_Gln236dup	disruptive_inframe_insertion	4/33		NP_620614.2
SMARCA2	NM_001289397.2	c.687_707dupGCAGCAGCAGCAGCAGCAGCA	p.Gln230_Gln236dup	disruptive_inframe_insertion	4/33		NP_001276326.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
SMARCA2	ENST00000349721.8	c.687_707dupGCAGCAGCAGCAGCAGCAGCA	p.Gln230_Gln236dup	disruptive_inframe_insertion	4/34	5	NM_003070.5	ENSP00000265773.5

Frequencies

GnomAD3 genomes AF: 0.0000332 AC: 5 AN: 150432 Hom.: 0 Cov.: 26

Gnomad AFR AF: 0.0000245

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000592

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000180 AC: 26 AN: 1445808 Hom.: 0 Cov.: 28 AF XY: 0.0000223 AC XY: 16 AN XY: 718560

Gnomad4 AFR exome AF: 0.0000305

Gnomad4 AMR exome AF: 0.0000234

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000260

Gnomad4 SAS exome AF: 0.0000236

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000181

Gnomad4 OTH exome AF: 0.0000167

GnomAD4 genome AF: 0.0000332 AC: 5 AN: 150432 Hom.: 0 Cov.: 26 AF XY: 0.0000409 AC XY: 3 AN XY: 73378

Gnomad4 AFR AF: 0.0000245

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000592

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs113070757; hg19: chr9-2039776;