chr9-92474742-C-CTCATCATCATCATCATCATCA

Variant names:

• chr9-92474742-C-CTCATCATCATCATCATCATCA
• rs3078372
• NM_017680.6:c.135_155dupTGATGATGATGATGATGATGA

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_017680.6(ASPN):​c.135_155dupTGATGATGATGATGATGATGA​(p.Asp45_Asp51dup) variant causes a disruptive inframe insertion change. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0000068 (0 hom., cov: 0)
  • Exomes 𝑓: 0.0000072 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: ASPN NM_017680.6 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 4.52
• Publications: 9 publications found

Genes affected

ASPN (HGNC:14872): (asporin) This gene encodes a cartilage extracellular protein that is member of the small leucine-rich proteoglycan family. The encoded protein may regulate chondrogenesis by inhibiting transforming growth factor-beta 1-induced gene expression in cartilage. This protein also binds collagen and calcium and may induce collagen mineralization. Polymorphisms in the aspartic acid repeat region of this gene are associated with a susceptibility to osteoarthritis, and also with intervertebral disc disease. Alternative splicing of this gene results in multiple transcript variants.[provided by RefSeq, Jul 2014]

CENPP (HGNC:32933): (centromere protein P) CENPP is a subunit of a CENPH (MIM 605607)-CENPI (MIM 300065)-associated centromeric complex that targets CENPA (MIM 117139) to centromeres and is required for proper kinetochore function and mitotic progression (Okada et al., 2006 [PubMed 16622420]).[supplied by OMIM, Mar 2008]

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_017680.6

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_017680.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ASPN	NM_017680.6	MANE Select	c.135_155dupTGATGATGATGATGATGATGA	p.Asp45_Asp51dup	disruptive_inframe_insertion	Exon 2 of 8	NP_060150.4
	CENPP	NM_001012267.3	MANE Select	c.564+94907_564+94927dupATCATCATCATCATCATCATC		intron	N/A	NP_001012267.1	Q6IPU0-1
	ASPN	NM_001193335.3		c.135_155dupTGATGATGATGATGATGATGA	p.Asp45_Asp51dup	disruptive_inframe_insertion	Exon 2 of 6	NP_001180264.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ASPN	ENST00000375544.7	TSL:1	c.135_155dupTGATGATGATGATGATGATGA	p.Asp45_Asp51dup	disruptive_inframe_insertion	Exon 2 of 8	ENSP00000364694.3	Q9BXN1
	CENPP	ENST00000375587.8	TSL:1 MANE Select	c.564+94907_564+94927dupATCATCATCATCATCATCATC		intron	N/A	ENSP00000364737.3	Q6IPU0-1
	ASPN	ENST00000907468.1		c.135_155dupTGATGATGATGATGATGATGA	p.Asp45_Asp51dup	disruptive_inframe_insertion	Exon 3 of 9	ENSP00000577527.1

Frequencies

GnomAD3 genomes AF: 0.00000678 AC: 1 AN: 147588 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000149

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000721 AC: 10 AN: 1387046 Hom.: 0 Cov.: 0 AF XY: 0.00000869 AC XY: 6 AN XY: 690652

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 30720

American (AMR) AF: 0.00 AC: 0 AN: 41068

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 24902

East Asian (EAS) AF: 0.00 AC: 0 AN: 37702

South Asian (SAS) AF: 0.00 AC: 0 AN: 81708

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 50526

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5576

European-Non Finnish (NFE) AF: 0.00000946 AC: 10 AN: 1057302

Other (OTH) AF: 0.00 AC: 0 AN: 57542

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.0000362579), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00000678 AC: 1 AN: 147588 Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0 AN XY: 71680

African (AFR) AF: 0.00 AC: 0 AN: 39564

American (AMR) AF: 0.00 AC: 0 AN: 14670

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3432

East Asian (EAS) AF: 0.00 AC: 0 AN: 5002

South Asian (SAS) AF: 0.00 AC: 0 AN: 4568

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 9962

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 310

European-Non Finnish (NFE) AF: 0.0000149 AC: 1 AN: 67178

Other (OTH) AF: 0.00 AC: 0 AN: 2004

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.5
Mutation Taster		=79/21	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3078372; hg19: chr9-95237024;