chr9-98290631-G-GGCGGGGGCTGGCGGTGGGGCTGAC
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_005458.8(GABBR2):c.2755_2778dupGTCAGCCCCACCGCCAGCCCCCGC(p.Arg926_His927insValSerProThrAlaSerProArg) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_005458.8 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- developmental and epileptic encephalopathy, 59Inheritance: AD Classification: STRONG, MODERATE Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- neurodevelopmental disorder with poor language and loss of hand skillsInheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- complex neurodevelopmental disorderInheritance: AD Classification: MODERATE Submitted by: ClinGen
- atypical Rett syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_005458.8. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| GABBR2 | TSL:1 MANE Select | c.2755_2778dupGTCAGCCCCACCGCCAGCCCCCGC | p.Arg926_His927insValSerProThrAlaSerProArg | conservative_inframe_insertion | Exon 19 of 19 | ENSP00000259455.2 | O75899 | ||
| GABBR2 | c.2689_2712dupGTCAGCCCCACCGCCAGCCCCCGC | p.Arg904_His905insValSerProThrAlaSerProArg | conservative_inframe_insertion | Exon 18 of 18 | ENSP00000601585.1 | ||||
| GABBR2 | c.2674_2697dupGTCAGCCCCACCGCCAGCCCCCGC | p.Arg899_His900insValSerProThrAlaSerProArg | conservative_inframe_insertion | Exon 18 of 18 | ENSP00000617435.1 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 exome Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at