chr9-98290631-G-GGCGGGGGCTGGCGGTGGGGCTGAC

Variant names:

• chr9-98290631-G-GGCGGGGGCTGGCGGTGGGGCTGAC
• rs2131331420
• NM_005458.8:c.2755_2778dupGTCAGCCCCACCGCCAGCCCCCGC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_005458.8(GABBR2):​c.2755_2778dupGTCAGCCCCACCGCCAGCCCCCGC​(p.Arg926_His927insValSerProThrAlaSerProArg) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: GABBR2 NM_005458.8 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.39
• Publications: 0 publications found

Genes affected

GABBR2 (HGNC:4507): (gamma-aminobutyric acid type B receptor subunit 2) The multi-pass membrane protein encoded by this gene belongs to the G-protein coupled receptor 3 family and GABA-B receptor subfamily. The GABA-B receptors inhibit neuronal activity through G protein-coupled second-messenger systems, which regulate the release of neurotransmitters, and the activity of ion channels and adenylyl cyclase. This receptor subunit forms an active heterodimeric complex with GABA-B receptor subunit 1, neither of which is effective on its own. Allelic variants of this gene have been associated with nicotine dependence.[provided by RefSeq, Jan 2010]

GABBR2 Gene-Disease associations (from GenCC):

• developmental and epileptic encephalopathy, 59

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• neurodevelopmental disorder with poor language and loss of hand skills

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• complex neurodevelopmental disorder

  Inheritance: AD Classification: MODERATE Submitted by: ClinGen
• atypical Rett syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_005458.8.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_005458.8. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GABBR2	NM_005458.8	MANE Select	c.2755_2778dupGTCAGCCCCACCGCCAGCCCCCGC	p.Arg926_His927insValSerProThrAlaSerProArg	conservative_inframe_insertion	Exon 19 of 19	NP_005449.5

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GABBR2	ENST00000259455.4	TSL:1 MANE Select	c.2755_2778dupGTCAGCCCCACCGCCAGCCCCCGC	p.Arg926_His927insValSerProThrAlaSerProArg	conservative_inframe_insertion	Exon 19 of 19	ENSP00000259455.2	O75899
	GABBR2	ENST00000931526.1		c.2689_2712dupGTCAGCCCCACCGCCAGCCCCCGC	p.Arg904_His905insValSerProThrAlaSerProArg	conservative_inframe_insertion	Exon 18 of 18	ENSP00000601585.1
	GABBR2	ENST00000947376.1		c.2674_2697dupGTCAGCCCCACCGCCAGCCCCCGC	p.Arg899_His900insValSerProThrAlaSerProArg	conservative_inframe_insertion	Exon 18 of 18	ENSP00000617435.1

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 31

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Epileptic encephalopathy (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs2131331420; hg19: chr9-101052913;