chrX-108687498-T-TGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCC
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_033380.3(COL4A5):c.4333_4367dupGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCC(p.Gly1457ValfsTer109) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. P1456P) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_033380.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- Alport syndromeInheritance: XL Classification: DEFINITIVE Submitted by: G2P, ClinGen
- X-linked Alport syndromeInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp, Myriad Women’s Health
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_033380.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| COL4A5 | MANE Select | c.4333_4367dupGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCC | p.Gly1457ValfsTer109 | frameshift | Exon 49 of 53 | NP_203699.1 | P29400-2 | ||
| COL4A5 | c.4315_4349dupGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCC | p.Gly1451ValfsTer109 | frameshift | Exon 47 of 51 | NP_000486.1 | P29400-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| COL4A5 | TSL:1 MANE Select | c.4333_4367dupGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCC | p.Gly1457ValfsTer109 | frameshift | Exon 49 of 53 | ENSP00000331902.7 | P29400-2 | ||
| COL4A5 | c.4327_4361dupGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCC | p.Gly1455ValfsTer109 | frameshift | Exon 47 of 51 | ENSP00000619202.1 | ||||
| COL4A5 | TSL:2 | c.4315_4349dupGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCC | p.Gly1451ValfsTer109 | frameshift | Exon 47 of 51 | ENSP00000354505.2 | P29400-1 |
Frequencies
GnomAD3 genomes Cov.: 23
GnomAD4 exome Cov.: 30
GnomAD4 genome Cov.: 23
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.