chrX-108694777-ATTATGTTCCTTCTCCTTTTCC-CA
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_033380.3(COL4A5):c.4707-30_4707-9delATTATGTTCCTTCTCCTTTTCCinsCA variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. There are indicators that this mutation may affect the branch point..
Frequency
Consequence
NM_033380.3 intron
Scores
Clinical Significance
Conservation
Publications
- Alport syndromeInheritance: XL Classification: DEFINITIVE Submitted by: G2P, ClinGen
- X-linked Alport syndromeInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp, Myriad Women’s Health
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_033380.3. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| COL4A5 | TSL:1 MANE Select | c.4707-30_4707-9delATTATGTTCCTTCTCCTTTTCCinsCA | intron | N/A | ENSP00000331902.7 | P29400-2 | |||
| COL4A5 | c.4701-30_4701-9delATTATGTTCCTTCTCCTTTTCCinsCA | intron | N/A | ENSP00000619202.1 | |||||
| COL4A5 | TSL:2 | c.4689-30_4689-9delATTATGTTCCTTCTCCTTTTCCinsCA | intron | N/A | ENSP00000354505.2 | P29400-1 |
Frequencies
GnomAD3 genomes Cov.: 22
GnomAD4 genome Cov.: 22
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at