chrX-136648356-GATTGGGTCAGCACTTTTTGCTGTGTATCTTC-G

Variant names:

• chrX-136648356-GATTGGGTCAGCACTTTTTGCTGTGTATCTTC-G
• NM_000074.3:c.111_141delTGGGTCAGCACTTTTTGCTGTGTATCTTCAT

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_000074.3(CD40LG):​c.111_141delTGGGTCAGCACTTTTTGCTGTGTATCTTCAT​(p.Gly38GlufsTer6) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 22)
• Consequence: CD40LG NM_000074.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 5.92

Genes affected

CD40LG (HGNC:11935): (CD40 ligand) The protein encoded by this gene is expressed on the surface of T cells. It regulates B cell function by engaging CD40 on the B cell surface. A defect in this gene results in an inability to undergo immunoglobulin class switch and is associated with hyper-IgM syndrome. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant X-136648356-GATTGGGTCAGCACTTTTTGCTGTGTATCTTC-G is Pathogenic according to our data. Variant chrX-136648356-GATTGGGTCAGCACTTTTTGCTGTGTATCTTC-G is described in ClinVar as [Pathogenic]. Clinvar id is 2819043.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CD40LG	NM_000074.3	c.111_141delTGGGTCAGCACTTTTTGCTGTGTATCTTCAT	p.Gly38GlufsTer6	frameshift_variant	Exon 1 of 5	ENST00000370629.7	NP_000065.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CD40LG	ENST00000370629.7	c.111_141delTGGGTCAGCACTTTTTGCTGTGTATCTTCAT	p.Gly38GlufsTer6	frameshift_variant	Exon 1 of 5	1	NM_000074.3	ENSP00000359663.2

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hyper-IgM syndrome type 1 Pathogenic:1

Dec 08, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with CD40LG-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Gly38Glufs*6) in the CD40LG gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in CD40LG are known to be pathogenic (PMID: 15319456). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chrX-135730515;