chrX-154030633-GGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGTGGGAGCAGTGGCACGGGGGCCTTTGGGGACTCTGAGTGGTGGTGATGGTGGTGGTGCTCCTTCTTGGGGGGTGAGGAGGCGCTGCTGCTGCGCCCCTTGGGGCTGCTCTCCTTGCTTTTCCGCCCAGGGCTCTTACAGGTCTTCA-G
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1_StrongPP5_Very_Strong
The NM_001110792.2(MECP2):c.1043_1230del(p.Leu348ProfsTer6) variant causes a frameshift change. Variant has been reported in ClinVar as Pathogenic (★★).
Frequency
Consequence
NM_001110792.2 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 12 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
MECP2 | NM_001110792.2 | c.1043_1230del | p.Leu348ProfsTer6 | frameshift_variant | Exon 3 of 3 | ENST00000453960.7 | NP_001104262.1 | |
MECP2 | NM_004992.4 | c.1007_1194del | p.Leu336ProfsTer6 | frameshift_variant | Exon 4 of 4 | ENST00000303391.11 | NP_004983.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
MECP2 | ENST00000453960.7 | c.1043_1230del | p.Leu348ProfsTer6 | frameshift_variant | Exon 3 of 3 | 1 | NM_001110792.2 | ENSP00000395535.2 | ||
MECP2 | ENST00000303391.11 | c.1007_1194del | p.Leu336ProfsTer6 | frameshift_variant | Exon 4 of 4 | 1 | NM_004992.4 | ENSP00000301948.6 |
Frequencies
GnomAD3 genomes Cov.: 17
GnomAD4 genome Cov.: 17
ClinVar
Submissions by phenotype
Severe neonatal-onset encephalopathy with microcephaly Pathogenic:1
This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Leu336Profs*6) in the MECP2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 151 amino acid(s) of the MECP2 protein. This variant has not been reported in the literature in individuals affected with MECP2-related conditions. For these reasons, this variant has been classified as Pathogenic. This variant disrupts a region of the MECP2 protein in which other variant(s) (p.Pro469Alafs*18) have been determined to be pathogenic (PMID: 32860008; Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. ClinVar contains an entry for this variant (Variation ID: 211450). -
Rett syndrome Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at