chrX-154030633-GGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGTGGGAGCAGTGGCACGGGGGCCTTTGGGGACTCTGAGTGGTGGTGATGGTGGTGGTGCTCCTTCTTGGGGGGTGAGGAGGCGCTGCTGCTGCGCCCCTTGGGGCTGCTCTCCTTGCTTTTCCGCCCAGGGCTCTTACAGGTCTTCA-G
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_001110792.2(MECP2):c.1043_1230del(p.Leu348ProfsTer6) variant causes a frameshift change. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. L348L) has been classified as Likely benign.
Frequency
Consequence
NM_001110792.2 frameshift
Scores
Clinical Significance
Conservation
Publications
- chromosome Xq28 duplication syndromeInheritance: XL Classification: DEFINITIVE Submitted by: G2P
- Rett syndromeInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
- severe neonatal-onset encephalopathy with microcephalyInheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
- syndromic X-linked intellectual disability Lubs typeInheritance: XL Classification: DEFINITIVE Submitted by: G2P
- atypical Rett syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- non-syndromic X-linked intellectual disabilityInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- X-linked intellectual disability-psychosis-macroorchidism syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- systemic lupus erythematosusInheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001110792.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MECP2 | NM_001110792.2 | MANE Select | c.1043_1230del | p.Leu348ProfsTer6 | frameshift | Exon 3 of 3 | NP_001104262.1 | ||
| MECP2 | NM_004992.4 | MANE Plus Clinical | c.1007_1194del | p.Leu336ProfsTer6 | frameshift | Exon 4 of 4 | NP_004983.1 | ||
| MECP2 | NM_001316337.2 | c.728_915del | p.Leu243ProfsTer6 | frameshift | Exon 5 of 5 | NP_001303266.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MECP2 | ENST00000453960.7 | TSL:1 MANE Select | c.1043_1230del | p.Leu348ProfsTer6 | frameshift | Exon 3 of 3 | ENSP00000395535.2 | ||
| MECP2 | ENST00000303391.11 | TSL:1 MANE Plus Clinical | c.1007_1194del | p.Leu336ProfsTer6 | frameshift | Exon 4 of 4 | ENSP00000301948.6 | ||
| MECP2 | ENST00000630151.3 | TSL:5 | c.1007_1194del | p.Leu336ProfsTer6 | frameshift | Exon 4 of 4 | ENSP00000486089.2 |
Frequencies
GnomAD3 genomes Cov.: 17
GnomAD4 genome Cov.: 17
ClinVar
Submissions by phenotype
Rett syndrome Pathogenic:1
Severe neonatal-onset encephalopathy with microcephaly Pathogenic:1
This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Leu336Profs*6) in the MECP2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 151 amino acid(s) of the MECP2 protein. This variant has not been reported in the literature in individuals affected with MECP2-related conditions. For these reasons, this variant has been classified as Pathogenic. This variant disrupts a region of the MECP2 protein in which other variant(s) (p.Pro469Alafs*18) have been determined to be pathogenic (PMID: 32860008; Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. ClinVar contains an entry for this variant (Variation ID: 211450).
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at