chrX-25013530-GGCCGCGGCGGCCGCGGCCGCGGCT-G
Variant summary
Our verdict is Benign. The variant received -14 ACMG points: 2P and 16B. PM4BP6_Very_StrongBS1BS2
The NM_139058.3(ARX):c.441_464delAGCCGCGGCCGCGGCCGCCGCGGC(p.Ala148_Ala155del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000533 in 813,782 control chromosomes in the GnomAD database, including 2 homozygotes. There are 124 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. A147A) has been classified as Likely benign.
Frequency
Consequence
NM_139058.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- genetic developmental and epileptic encephalopathyInheritance: AD, XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- intellectual disability, X-linked, with or without seizures, ARX-relatedInheritance: XL Classification: DEFINITIVE, MODERATE Submitted by: Ambry Genetics, G2P
- Partington syndromeInheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P
- X-linked complex neurodevelopmental disorderInheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
- X-linked lissencephaly with abnormal genitaliaInheritance: XL Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
- infantile spasmsInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- corpus callosum agenesis-abnormal genitalia syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- infantile epileptic-dyskinetic encephalopathyInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- non-syndromic X-linked intellectual disabilityInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- X-linked spasticity-intellectual disability-epilepsy syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -14 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_139058.3. You can select a different transcript below to see updated ACMG assignments.
Frequencies
GnomAD3 genomes AF: 0.000707 AC: 74AN: 104666Hom.: 0 Cov.: 21 show subpopulations
GnomAD2 exomes AF: 0.000393 AC: 1AN: 2544 AF XY: 0.00314 show subpopulations
GnomAD4 exome AF: 0.000508 AC: 360AN: 709130Hom.: 2 AF XY: 0.000461 AC XY: 99AN XY: 214590 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000707 AC: 74AN: 104652Hom.: 0 Cov.: 21 AF XY: 0.000836 AC XY: 25AN XY: 29920 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at