chrX-48509815-TCTGCAATGGCCACCTTTAGCCGCCAGGAA-CCACC

Variant names:

• chrX-48509815-TCTGCAATGGCCACCTTTAGCCGCCAGGAA-CCACC
• NM_203475.3:c.-6_24delTCTGCAATGGCCACCTTTAGCCGCCAGGAAinsCCACC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_203475.3(PORCN):​c.-6_24delTCTGCAATGGCCACCTTTAGCCGCCAGGAAinsCCACC​(p.Met1fs) variant causes a frameshift, start lost, synonymous change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 22)
• Consequence: PORCN NM_203475.3 frameshift, start_lost, synonymous
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 8.24

Genes affected

PORCN (HGNC:17652): (porcupine O-acyltransferase) This gene belongs to the evolutionarily conserved porcupine (Porc) gene family. Genes of the porcupine family encode endoplasmic reticulum proteins with multiple transmembrane domains. Porcupine proteins are involved in the processing of Wnt (wingless and int homologue) proteins. Disruption of this gene is associated with focal dermal hypoplasia, and the encoded protein has been implicated in cancer. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Aug 2013]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 52 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant X-48509815-TCTGCAATGGCCACCTTTAGCCGCCAGGAA-CCACC is Pathogenic according to our data. Variant chrX-48509815-TCTGCAATGGCCACCTTTAGCCGCCAGGAA-CCACC is described in ClinVar as [Likely_pathogenic]. Clinvar id is 3544364.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PORCN	NM_203475.3	c.-6_24delTCTGCAATGGCCACCTTTAGCCGCCAGGAAinsCCACC	p.Met1fs	frameshift_variant, start_lost, synonymous_variant	Exon 2 of 15	ENST00000326194.11	NP_982301.1
PORCN	NM_203475.3	c.-6_24delTCTGCAATGGCCACCTTTAGCCGCCAGGAAinsCCACC		5_prime_UTR_variant	Exon 2 of 15	ENST00000326194.11	NP_982301.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PORCN	ENST00000326194.11	c.-6_24delTCTGCAATGGCCACCTTTAGCCGCCAGGAAinsCCACC	p.Met1fs	frameshift_variant, start_lost, synonymous_variant	Exon 2 of 15	1	NM_203475.3	ENSP00000322304.6
PORCN	ENST00000326194	c.-6_24delTCTGCAATGGCCACCTTTAGCCGCCAGGAAinsCCACC		5_prime_UTR_variant	Exon 2 of 15	1	NM_203475.3	ENSP00000322304.6

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Focal dermal hypoplasia Pathogenic:1

Dec 17, 2024

Department of Human Genetics, University Hospital Bern, Inselspital

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The deletion-insertion variant has not been observed in large population cohorts (gnomAD) and to our knowledge has not been previously published. The variant leads to the loss of the initiation codon and presumably to the utilisation of an alternative initiation codon. Other variants affecting the initiation codon have previously been described in patients affected with focal dermal hypoplasia (PMID: 19309688, 21472892). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chrX-48368203;