chrX-48683814-ACCCAGAGCCTCGCCAGAGAAGACAAGGGCAGAAAGCACCATGAGTGGGGGCCCAATGGGAGGAAGGCCCGGGGGCCGAGGAGCACCAGCGGTTCAGCAGAACATACCCTCCACCCTCCTCCAGGACCACGAGAACCAGCGACTCTTTGAGATGCTTGGACGAAAATGCTTGGTGAGCTGGGGATCTCCTGCCCCCGCCCCGTCC-A
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4PP5_Moderate
The ENST00000376701.5(WAS):c.-39_132+33del(p.Met1_Leu44del) variant causes a start lost, conservative inframe deletion, splice region change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Consequence
ENST00000376701.5 start_lost, conservative_inframe_deletion, splice_region
Scores
Clinical Significance
Conservation
Publications
- Wiskott-Aldrich syndromeInheritance: XL, AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Orphanet, Ambry Genetics
- X-linked severe congenital neutropeniaInheritance: XL Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, ClinGen, Labcorp Genetics (formerly Invitae), Ambry Genetics
- thrombocytopenia 1Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: ENST00000376701.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| WAS | NM_000377.3 | MANE Select | c.-37_132+35del | p.Met1fs | frameshift start_lost splice_region | Exon 1 of 12 | NP_000368.1 | P42768 | |
| WAS | NM_000377.3 | MANE Select | c.-37_132+35del | splice_donor splice_region 5_prime_UTR intron | Exon 1 of 12 | NP_000368.1 | P42768 | ||
| WAS | NM_001438877.1 | c.-37_132+35del | p.Met1fs | frameshift start_lost splice_region | Exon 1 of 12 | NP_001425806.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| WAS | ENST00000376701.5 | TSL:1 MANE Select | c.-39_132+33del | p.Met1_Leu44del | start_lost conservative_inframe_deletion splice_region | Exon 1 of 12 | ENSP00000365891.4 | P42768 | |
| WAS | ENST00000376701.5 | TSL:1 MANE Select | c.-39_132+33del | splice_donor splice_region 5_prime_UTR intron | Exon 1 of 12 | ENSP00000365891.4 | P42768 | ||
| WAS | ENST00000698635.1 | c.-39_132+33del | p.Met1_Leu44del | start_lost conservative_inframe_deletion splice_region | Exon 1 of 12 | ENSP00000513850.1 | A0A8V8TM35 |
Frequencies
GnomAD3 genomes Cov.: 22
GnomAD4 genome Cov.: 22
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at