chrX-50092156-GGATGTGTTAAAGCATATAGCACA-G

Position:

• chrX-50092156-GGATGTGTTAAAGCATATAGCACA-G

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PVS1_Moderate PM2 PP5

The NM_001127898.4(CLCN5):​c.2393_2415delTGTTAAAGCATATAGCACAGATG​(p.Val798fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 23)
• Consequence: CLCN5 NM_001127898.4 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.85

Genes affected

CLCN5 (HGNC:2023): (chloride voltage-gated channel 5) This gene encodes a member of the ClC family of chloride ion channels and ion transporters. The encoded protein is primarily localized to endosomal membranes and may function to facilitate albumin uptake by the renal proximal tubule. Mutations in this gene have been found in Dent disease and renal tubular disorders complicated by nephrolithiasis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2013]

ACMG classification

Verdict is Uncertain_significance. Variant got 5 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0237 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant X-50092156-GGATGTGTTAAAGCATATAGCACA-G is Pathogenic according to our data. Variant chrX-50092156-GGATGTGTTAAAGCATATAGCACA-G is described in ClinVar as [Pathogenic]. Clinvar id is 208002.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CLCN5	NM_001127898.4	c.2393_2415delTGTTAAAGCATATAGCACAGATG	p.Val798fs	frameshift_variant	15/15	ENST00000376091.8	NP_001121370.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CLCN5	ENST00000376091.8	c.2393_2415delTGTTAAAGCATATAGCACAGATG	p.Val798fs	frameshift_variant	15/15	2	NM_001127898.4	ENSP00000365259.3

Frequencies

GnomAD3 genomes Cov.: 23

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 23

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Dent disease type 1 Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

GeneReviews

Sep 25, 2014

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs797044815; hg19: chrX-49856813;