rs1041809852
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_004168.4(SDHA):c.762_770+17delTGCCACAGGGTAGGAATCTCATTTCT(p.Ala255_Gly257del) variant causes a splice donor, disruptive inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★).
Frequency
Consequence
NM_004168.4 splice_donor, disruptive_inframe_deletion, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- hereditary pheochromocytoma-paragangliomaInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
- pheochromocytoma/paraganglioma syndrome 5Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Illumina, G2P, PanelApp Australia, Labcorp Genetics (formerly Invitae)
- mitochondrial complex II deficiency, nuclear type 1Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- neurodegeneration with ataxia and late-onset optic atrophyInheritance: AD Classification: STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
- Leigh syndromeInheritance: AR Classification: MODERATE Submitted by: ClinGen, Ambry Genetics
- familial isolated dilated cardiomyopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- gastrointestinal stromal tumorInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Leigh syndrome with leukodystrophyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- mitochondrial complex II deficiencyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- dilated cardiomyopathy 1GGInheritance: AR Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004168.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SDHA | MANE Select | c.762_770+17delTGCCACAGGGTAGGAATCTCATTTCT | p.Ala255_Gly257del | splice_donor disruptive_inframe_deletion splice_region intron | Exon 6 of 15 | NP_004159.2 | P31040-1 | ||
| SDHA | c.618_626+17delTGCCACAGGGTAGGAATCTCATTTCT | p.Ala207_Gly209del | splice_donor disruptive_inframe_deletion splice_region intron | Exon 5 of 14 | NP_001281261.1 | P31040-2 | |||
| SDHA | c.762_770+17delTGCCACAGGGTAGGAATCTCATTTCT | p.Ala255_Gly257del | splice_donor disruptive_inframe_deletion splice_region intron | Exon 6 of 13 | NP_001317687.1 | D6RFM5 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SDHA | TSL:1 MANE Select | c.761_770+16delTTGCCACAGGGTAGGAATCTCATTTC | p.Val254LeufsTer57 | frameshift splice_donor splice_region intron | Exon 6 of 15 | ENSP00000264932.6 | P31040-1 | ||
| ENSG00000286001 | n.761_770+16delTTGCCACAGGGTAGGAATCTCATTTC | splice_donor splice_region intron non_coding_transcript_exon | Exon 6 of 24 | ENSP00000499215.1 | A0A494C1T6 | ||||
| SDHA | c.761_770+16delTTGCCACAGGGTAGGAATCTCATTTC | p.Val254LeufsTer57 | frameshift splice_donor splice_region intron | Exon 6 of 16 | ENSP00000544294.1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD2 exomes AF: 0.00000398 AC: 1AN: 251180 AF XY: 0.00 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000958 AC: 14AN: 1461602Hom.: 0 AF XY: 0.00000963 AC XY: 7AN XY: 727108 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.