rs1041809852

Variant names:

• chr5-228323-GTTGCCACAGGGTAGGAATCTCATTTC-G
• rs1041809852
• NM_004168.4:c.762_770+17delTGCCACAGGGTAGGAATCTCATTTCT

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_004168.4(SDHA):​c.762_770+17delTGCCACAGGGTAGGAATCTCATTTCT​(p.Ala255_Gly257del) variant causes a splice donor, disruptive inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000096 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: SDHA NM_004168.4 splice_donor, disruptive_inframe_deletion, splice_region, intron
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:5
• Conservation: PhyloP100: 9.43

Genes affected

SDHA (HGNC:10680): (succinate dehydrogenase complex flavoprotein subunit A) This gene encodes a major catalytic subunit of succinate-ubiquinone oxidoreductase, a complex of the mitochondrial respiratory chain. The complex is composed of four nuclear-encoded subunits and is localized in the mitochondrial inner membrane. Mutations in this gene have been associated with a form of mitochondrial respiratory chain deficiency known as Leigh Syndrome. A pseudogene has been identified on chromosome 3q29. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]

ENSG00000286001 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 5-228323-GTTGCCACAGGGTAGGAATCTCATTTC-G is Pathogenic according to our data. Variant chr5-228323-GTTGCCACAGGGTAGGAATCTCATTTC-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 412346.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SDHA	NM_004168.4	c.762_770+17delTGCCACAGGGTAGGAATCTCATTTCT	p.Ala255_Gly257del	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 6 of 15	ENST00000264932.11	NP_004159.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SDHA	ENST00000264932.11	c.761_770+16delTTGCCACAGGGTAGGAATCTCATTTC	p.Val254LeufsTer57	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 6 of 15	1	NM_004168.4	ENSP00000264932.6
ENSG00000286001	ENST00000651543.1	n.761_770+16delTTGCCACAGGGTAGGAATCTCATTTC		splice_donor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant	Exon 6 of 24			ENSP00000499215.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD3 exomes AF: 0.00000398 AC: 1 AN: 251180 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 135746

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000881

Gnomad OTH exome AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000958 AC: 14 AN: 1461602 Hom.: 0 AF XY: 0.00000963 AC XY: 7 AN XY: 727108

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000117

Gnomad4 OTH exome AF: 0.0000166

GnomAD4 genome Cov.: 33

Bravo AF: 0.00000378

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:5

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Dilated cardiomyopathy 1GG;C3279992:Paragangliomas 5;C5543254:Neurodegeneration with ataxia and late-onset optic atrophy;C5700310:Mitochondrial complex II deficiency, nuclear type 1 Pathogenic:1

Oct 16, 2021

Fulgent Genetics, Fulgent Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Paragangliomas 5;C5700310:Mitochondrial complex II deficiency, nuclear type 1 Pathogenic:1

Oct 31, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant results in the deletion of part of exon 6 (c.762_770+17del) of the SDHA gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in SDHA are known to be pathogenic (PMID: 22974104, 24781757). This variant is present in population databases (no rsID available, gnomAD 0.0009%). This variant has been observed in individual(s) with metastatic paraganglioma (PMID: 32688340). ClinVar contains an entry for this variant (Variation ID: 412346). For these reasons, this variant has been classified as Pathogenic. -

Dilated cardiomyopathy 1GG Pathogenic:1

Mar 28, 2023

Baylor Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Hereditary cancer-predisposing syndrome Pathogenic:1

Feb 15, 2024

Ambry Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.762_770+17del26 variant results from a deletion of 26 nucleotides from nucleotide position 762 to 770+17 and involves the canonical splice donor site after coding exon 6 of the SDHA gene. This alteration was identified in an individual with a paraganglioma diagnosed at age 19 (Main Am et al. Endocr Connect, 2020 Aug;9(8):793-803). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). The canonical splice donor site is highly conserved in available vertebrate species. In silico splice site analysis predicts that this alteration will weaken the native splice donor site; however, direct evidence is insufficient at this time (Ambry internal data). Alterations that disrupt the canonical splice site are expected to cause aberrant splicing, resulting in an abnormal protein or a transcript that is subject to nonsense-mediated mRNA decay. As such, this alteration is classified as likely pathogenic. -

Paragangliomas 5 Pathogenic:1

Feb 13, 2023

Myriad Genetics, Inc.

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered likely pathogenic. This variant occurs within a consensus splice junction and is predicted to result in abnormal mRNA splicing of either an out-of-frame exon or an in-frame exon necessary for protein stability and/or normal function. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1041809852; hg19: chr5-228438;