rs104886359

Positions:

• chrX-108620289-ATCCAGGACCTCCTGGACTTGATGT-A

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PM1 PM2 PM4 PP3 PP5

The NM_033380.3(COL4A5):​c.2550_2573delTCCTGGACTTGATGTTCCAGGACC​(p.Pro851_Pro858del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in Lovd as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 22)
• Consequence: COL4A5 NM_033380.3 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 8.95

Genes affected

COL4A5 (HGNC:2207): (collagen type IV alpha 5 chain) This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. Mutations in this gene are associated with X-linked Alport syndrome, also known as hereditary nephritis. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Aug 2010]

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PM1: In a compositionally_biased_region Pro residues (size 31) in uniprot entity CO4A5_HUMAN there are 4 pathogenic changes around while only 0 benign (100%) in NM_033380.3
• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_033380.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant X-108620289-ATCCAGGACCTCCTGGACTTGATGT-A is Pathogenic according to our data. Variant chrX-108620289-ATCCAGGACCTCCTGGACTTGATGT-A is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
COL4A5	NM_033380.3	c.2550_2573delTCCTGGACTTGATGTTCCAGGACC	p.Pro851_Pro858del	disruptive_inframe_deletion	31/53	ENST00000328300.11	NP_203699.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
COL4A5	ENST00000328300.11	c.2550_2573delTCCTGGACTTGATGTTCCAGGACC	p.Pro851_Pro858del	disruptive_inframe_deletion	31/53	1	NM_033380.3	ENSP00000331902.7
COL4A5	ENST00000483338.1	c.1374_1397delTCCTGGACTTGATGTTCCAGGACC	p.Pro459_Pro466del	disruptive_inframe_deletion	15/20	1		ENSP00000495685.1
COL4A5	ENST00000361603.7	c.2550_2573delTCCTGGACTTGATGTTCCAGGACC	p.Pro851_Pro858del	disruptive_inframe_deletion	31/51	2		ENSP00000354505.2

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs104886359; hg19: chrX-107863519;