rs104895309

Variant names:

• chr12-109574806-TAGGATTCCCAGGAGCCATGTTGTCAGAAGTCCTACTGGTGTCTGCTCCGGGGAAAGTCATCCTTCATGGAGAACATGCCGTGGTACATGGCA-T
• rs104895309
• NM_000431.4:c.-13_78+1delATTCCCAGGAGCCATGTTGTCAGAAGTCCTACTGGTGTCTGCTCCGGGGAAAGTCATCCTTCATGGAGAACATGCCGTGGTACATGGCAAGG

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_000431.4(MVK):​c.-13_78+1delATTCCCAGGAGCCATGTTGTCAGAAGTCCTACTGGTGTCTGCTCCGGGGAAAGTCATCCTTCATGGAGAACATGCCGTGGTACATGGCAAGG​(p.Met1fs) variant causes a frameshift, start lost, splice region change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: MVK NM_000431.4 frameshift, start_lost, splice_region
• Clinical Significance: not provided no classification provided O:1
• Conservation: PhyloP100: 3.56
• Publications: 1 publications found

Genes affected

MVK (HGNC:7530): (mevalonate kinase) This gene encodes the peroxisomal enzyme mevalonate kinase. Mevalonate is a key intermediate, and mevalonate kinase a key early enzyme, in isoprenoid and sterol synthesis. Mevalonate kinase deficiency caused by mutation of this gene results in mevalonic aciduria, a disease characterized psychomotor retardation, failure to thrive, hepatosplenomegaly, anemia and recurrent febrile crises. Defects in this gene also cause hyperimmunoglobulinaemia D and periodic fever syndrome, a disorder characterized by recurrent episodes of fever associated with lymphadenopathy, arthralgia, gastrointestinal dismay and skin rash. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]

MVK Gene-Disease associations (from GenCC):

• porokeratosis 3, disseminated superficial actinic type

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
• hyperimmunoglobulinemia D with periodic fever

  Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P
• mevalonic aciduria

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Labcorp Genetics (formerly Invitae), Orphanet
• disseminated superficial actinic porokeratosis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• porokeratosis of Mibelli

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 101 pathogenic variants in the truncated region.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MVK	NM_000431.4	c.-13_78+1delATTCCCAGGAGCCATGTTGTCAGAAGTCCTACTGGTGTCTGCTCCGGGGAAAGTCATCCTTCATGGAGAACATGCCGTGGTACATGGCAAGG	p.Met1fs	frameshift_variant, start_lost, splice_region_variant	Exon 2 of 11	ENST00000228510.8	NP_000422.1
MVK	NM_000431.4	c.-13_78+1delATTCCCAGGAGCCATGTTGTCAGAAGTCCTACTGGTGTCTGCTCCGGGGAAAGTCATCCTTCATGGAGAACATGCCGTGGTACATGGCAAGG		splice_donor_variant, 5_prime_UTR_variant, intron_variant	Exon 2 of 11	ENST00000228510.8	NP_000422.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MVK	ENST00000228510.8	c.-14-277_-14-186delGATTCCCAGGAGCCATGTTGTCAGAAGTCCTACTGGTGTCTGCTCCGGGGAAAGTCATCCTTCATGGAGAACATGCCGTGGTACATGGCAAG		intron_variant	Intron 1 of 10	1	NM_000431.4	ENSP00000228510.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: not provided

Submissions summary: Other:1

Revision: no classification provided

Submissions by phenotype

Hyperimmunoglobulin D with periodic fever Other:1

-

Unité médicale des maladies autoinflammatoires, CHRU Montpellier

Significance: not provided

Review Status: no classification provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.6

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs104895309; hg19: chr12-110012611;