rs104895327

Variant names:

• chr12-109575996-AGGTAGCACTGGCTGTATCCTTGAACTTGAGAACATTCCTCCGGCTTCAACCCCACAGCAATGGGAAAGTGGACCTCAGCTTACCCAACATTGGTATCAAGCGGGCCTGGGATGTGGCCAGGCTTCAGTCACTGGACACAAGCTTTCTG-A
• rs104895327
• NM_000431.4:c.81_226+2del

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The ENST00000228510.8(MVK):​c.79-1_225del​(p.Val27_Glu76del) variant causes a splice acceptor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 32)
• Consequence: MVK ENST00000228510.8 splice_acceptor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 8.30
• Publications: 1 publications found

Genes affected

MVK (HGNC:7530): (mevalonate kinase) This gene encodes the peroxisomal enzyme mevalonate kinase. Mevalonate is a key intermediate, and mevalonate kinase a key early enzyme, in isoprenoid and sterol synthesis. Mevalonate kinase deficiency caused by mutation of this gene results in mevalonic aciduria, a disease characterized psychomotor retardation, failure to thrive, hepatosplenomegaly, anemia and recurrent febrile crises. Defects in this gene also cause hyperimmunoglobulinaemia D and periodic fever syndrome, a disorder characterized by recurrent episodes of fever associated with lymphadenopathy, arthralgia, gastrointestinal dismay and skin rash. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]

MVK Gene-Disease associations (from GenCC):

• porokeratosis 3, disseminated superficial actinic type

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
• hyperimmunoglobulinemia D with periodic fever

  Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P
• mevalonate kinase deficiency

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• mevalonic aciduria

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Labcorp Genetics (formerly Invitae)
• disseminated superficial actinic porokeratosis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• porokeratosis of Mibelli

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000228510.8. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MVK	NM_000431.4	MANE Select	c.81_226+2del	p.Leu29fs	frameshift splice_donor splice_region intron	Exon 3 of 11	NP_000422.1	Q03426
	MVK	NM_001414515.1		c.-502_-357+2del		splice_region	Exon 2 of 10	NP_001401444.1	B7Z1C2
	MVK	NM_001414512.1		c.81_226+2del	p.Leu29fs	frameshift splice_donor splice_region intron	Exon 3 of 12	NP_001401441.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MVK	ENST00000228510.8	TSL:1 MANE Select	c.79-1_225del	p.Val27_Glu76del	splice_acceptor conservative_inframe_deletion splice_region intron	Exon 3 of 11	ENSP00000228510.3	Q03426
	MVK	ENST00000546277.6	TSL:5	c.79-1_225del	p.Val27_Glu76del	splice_acceptor conservative_inframe_deletion splice_region intron	Exon 3 of 11	ENSP00000438153.2	Q03426
	MVK	ENST00000878306.1		c.79-1_225del	p.Val27_Glu76del	splice_acceptor conservative_inframe_deletion splice_region intron	Exon 3 of 11	ENSP00000548365.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs104895327; hg19: chr12-110013801;