rs1057517010

Variant names:

• chr17-19648991-GGGTCCGACAGGCGTTCCTGTCCGGCC-G
• rs767751416
• NM_000382.3:c.25_50delCGACAGGCGTTCCTGTCCGGCCGGTC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The ENST00000176643.11(ALDH3A2):​c.25_50delCGACAGGCGTTCCTGTCCGGCCGGTC​(p.Arg9AlafsTer36) variant causes a frameshift change. The variant allele was found at a frequency of 0.00000315 in 1,586,004 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. R9R) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 33)
  • Exomes 𝑓: 0.0000028 (0 hom.)
• Consequence: ALDH3A2 ENST00000176643.11 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:6
• Conservation: PhyloP100: 6.41
• Publications: 1 publications found

Genes affected

ALDH3A2 (HGNC:403): (aldehyde dehydrogenase 3 family member A2) Aldehyde dehydrogenase isozymes are thought to play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. This gene product catalyzes the oxidation of long-chain aliphatic aldehydes to fatty acid. Mutations in the gene cause Sjogren-Larsson syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

ALDH3A2 Gene-Disease associations (from GenCC):

• Sjogren-Larsson syndrome

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Myriad Women’s Health, PanelApp Australia, Labcorp Genetics (formerly Invitae), Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 140 pathogenic variants in the truncated region.
• PP5: Variant 17-19648991-GGGTCCGACAGGCGTTCCTGTCCGGCC-G is Pathogenic according to our data. Variant chr17-19648991-GGGTCCGACAGGCGTTCCTGTCCGGCC-G is described in ClinVar as Pathogenic. ClinVar VariationId is 371103.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000176643.11. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ALDH3A2	NM_000382.3	MANE Select	c.25_50delCGACAGGCGTTCCTGTCCGGCCGGTC	p.Arg9AlafsTer36	frameshift	Exon 1 of 10	NP_000373.1
	ALDH3A2	NM_001031806.2		c.25_50delCGACAGGCGTTCCTGTCCGGCCGGTC	p.Arg9AlafsTer36	frameshift	Exon 1 of 11	NP_001026976.1
	ALDH3A2	NM_001369136.1		c.25_50delCGACAGGCGTTCCTGTCCGGCCGGTC	p.Arg9AlafsTer36	frameshift	Exon 2 of 12	NP_001356065.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ALDH3A2	ENST00000176643.11	TSL:1 MANE Select	c.25_50delCGACAGGCGTTCCTGTCCGGCCGGTC	p.Arg9AlafsTer36	frameshift	Exon 1 of 10	ENSP00000176643.6
	ALDH3A2	ENST00000339618.8	TSL:1	c.25_50delCGACAGGCGTTCCTGTCCGGCCGGTC	p.Arg9AlafsTer36	frameshift	Exon 1 of 11	ENSP00000345774.4
	ALDH3A2	ENST00000671878.1		c.25_50delCGACAGGCGTTCCTGTCCGGCCGGTC	p.Arg9AlafsTer36	frameshift	Exon 1 of 10	ENSP00000500516.1

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152202 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.0000241

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000279 AC: 4 AN: 1433802 Hom.: 0 AF XY: 0.00000281 AC XY: 2 AN XY: 710592

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33206

American (AMR) AF: 0.00 AC: 0 AN: 40200

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25376

East Asian (EAS) AF: 0.00 AC: 0 AN: 38740

South Asian (SAS) AF: 0.00 AC: 0 AN: 82358

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 50172

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5404

European-Non Finnish (NFE) AF: 0.00000273 AC: 3 AN: 1099094

Other (OTH) AF: 0.0000169 AC: 1 AN: 59252

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000266003), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152202 Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0 AN XY: 74348

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000241 AC: 1 AN: 41450

American (AMR) AF: 0.00 AC: 0 AN: 15282

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5190

South Asian (SAS) AF: 0.00 AC: 0 AN: 4826

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10624

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68036

Other (OTH) AF: 0.00 AC: 0 AN: 2094

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.0000264

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
5	-	-	Sjögren-Larsson syndrome (5)
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.4
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs767751416; hg19: chr17-19552304;