rs1057520307

Variant names:

• chr10-48869-CCAGCGGAGTCGATGGCATGTT-C
• rs1057520307
• NM_177987.3:c.80_100delAACATGCCATCGACTCCGCTG

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP5

The NM_177987.3(TUBB8):​c.80_100delAACATGCCATCGACTCCGCTG​(p.Glu27_Ala33del) variant causes a disruptive inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: TUBB8 NM_177987.3 disruptive_inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 6.97
• Publications: 1 publications found

Genes affected

TUBB8 (HGNC:20773): (tubulin beta 8 class VIII) The protein encoded by this gene represents the primary beta-tubulin subunit of oocytes and the early embryo. Defects in this gene, which is primate-specific, are a cause of oocyte maturation defect 2 and infertility. [provided by RefSeq, Mar 2016]

TUBB8 Gene-Disease associations (from GenCC):

• oocyte maturation defect 2

  Inheritance: AR, SD, AD Classification: DEFINITIVE, STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_177987.3.
• PP5: Variant 10-48869-CCAGCGGAGTCGATGGCATGTT-C is Pathogenic according to our data. Variant chr10-48869-CCAGCGGAGTCGATGGCATGTT-C is described in ClinVar as Pathogenic. ClinVar VariationId is 378060.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_177987.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TUBB8	NM_177987.3	MANE Select	c.80_100delAACATGCCATCGACTCCGCTG	p.Glu27_Ala33del	disruptive_inframe_deletion	Exon 2 of 4	NP_817124.1
	TUBB8	NM_001389618.1		c.-137_-117delAACATGCCATCGACTCCGCTG		5_prime_UTR	Exon 3 of 5	NP_001376547.1
	TUBB8	NM_001389619.1		c.-137_-117delAACATGCCATCGACTCCGCTG		5_prime_UTR	Exon 3 of 5	NP_001376548.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TUBB8	ENST00000568584.6	TSL:1 MANE Select	c.80_100delAACATGCCATCGACTCCGCTG	p.Glu27_Ala33del	disruptive_inframe_deletion	Exon 2 of 4	ENSP00000456206.2
	TUBB8	ENST00000564130.2	TSL:5	c.4_24delAACATGCCATCGACTCCGCTG	p.Asn2_Leu8del	conservative_inframe_deletion	Exon 3 of 4	ENSP00000457610.1
	TUBB8	ENST00000568866.5	TSL:5	c.80_100delAACATGCCATCGACTCCGCTG	p.Glu27_Ala33del	disruptive_inframe_deletion	Exon 2 of 3	ENSP00000457062.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Oocyte maturation defect 2 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1057520307; hg19: chr10-94809;