rs1064792906

Variant names:

• chr11-64809823-TGGGCGGTGAAGCGGGCATAGA-T
• rs1064792906
• NM_001370259.2:c.266_286delTCTATGCCCGCTTCACCGCCC

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4 PP3 PP5

The NM_001370259.2(MEN1):​c.266_286delTCTATGCCCGCTTCACCGCCC​(p.Leu89_Ala95del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. L89L) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 31)
• Consequence: MEN1 NM_001370259.2 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:2
• Conservation: PhyloP100: 9.00
• Publications: 1 publications found

Genes affected

MEN1 (HGNC:7010): (menin 1) This gene encodes menin, a tumor suppressor associated with a syndrome known as multiple endocrine neoplasia type 1. Menin is a scaffold protein that functions in histone modification and epigenetic gene regulation. It is thought to regulate several pathways and processes by altering chromatin structure through the modification of histones. [provided by RefSeq, May 2019]

MEN1 Gene-Disease associations (from GenCC):

• multiple endocrine neoplasia type 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen, Orphanet, Ambry Genetics
• familial isolated hyperparathyroidism

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• pituitary gigantism

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• hereditary pheochromocytoma-paraganglioma

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001370259.2.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 11-64809823-TGGGCGGTGAAGCGGGCATAGA-T is Pathogenic according to our data. Variant chr11-64809823-TGGGCGGTGAAGCGGGCATAGA-T is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 403805.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MEN1	NM_001370259.2	c.266_286delTCTATGCCCGCTTCACCGCCC	p.Leu89_Ala95del	disruptive_inframe_deletion	Exon 2 of 10	ENST00000450708.7	NP_001357188.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MEN1	ENST00000450708.7	c.266_286delTCTATGCCCGCTTCACCGCCC	p.Leu89_Ala95del	disruptive_inframe_deletion	Exon 2 of 10	5	NM_001370259.2	ENSP00000394933.3

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:1 Uncertain:2

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not provided Pathogenic:1

Dec 14, 2016

GeneDx

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.266_286del21 variant in the MEN1 gene has previously been reported in association with multiple endocrine neoplasia type 1 (Lourenco et al., 2007; Toledo et al., 2007; Coutinho et al., 2010). This variant was not observed in approximately 6,500 individuals of European and African American ancestry in the NHLBI Exome Sequencing Project, indicating it is not a common benign variant in these populations. The c.266_286del21 variant is an in-frame deletion that results in the loss of seven amino acids, denoted p.Leu89_Ala95del. Five of the deleted residues are conserved across species, and in silico analysis predicts this variant is probably damaging to the protein structure/function. Based on currently available evidence, c.266_286del21 is a strong candidate for a pathogenic variant. However, the possibility it is a rare benign variant cannot be excluded. -

Multiple endocrine neoplasia, type 1 Uncertain:1

Dec 19, 2016

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, this is a rare in-frame deletion with uncertain impact on protein function that has been reported in an affected family. It has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. This variant is not present in population databases (ExAC no frequency). This sequence change deletes 21 nucleotides from exon 2 of the MEN1 mRNA (c.266_286del). This leads to the deletion of 7 amino acid residues from the MEN1 protein (p.Leu89_Ala95del) but otherwise preserves the integrity of the reading frame. This variant has been reported to segregate with multiple endocrine neoplasia type 1 in 3 members of a single family (PMID: 17555499). This variant is also known as 375del21 in the literature. -

Hereditary cancer-predisposing syndrome Uncertain:1

May 20, 2025

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.266_286del21 variant (also known as p.L89_A95del) is located in coding exon 1 of the MEN1 gene. This variant results from an in-frame deletion of 21 nucleotides at positions 266 to 286. This results in the in-frame deletion of 7 amino acids (LYARFTA) at codons 89 to 95. This variant was reported in individual(s) with features consistent with multiple endocrine neoplasia type 1 (MEN1) (Toledo RA et al. Clin Endocrinol (Oxf), 2007 Sep;67:377-84; Carvalho RA et al. Eur J Endocrinol, 2018 Dec;179:391-407). These amino acid positions are well conserved in available vertebrate species. In addition, this variant is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Based on the available evidence, the clinical significance of this variant remains unclear. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.0
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1064792906; hg19: chr11-64577295;