rs1064792906

Positions:

• chr11-64809823-TGGGCGGTGAAGCGGGCATAGA-T

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM2 PM4 PP3 PP5

The NM_001370259.2(MEN1):​c.266_286delTCTATGCCCGCTTCACCGCCC​(p.Leu89_Ala95del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency: Genomes: not found (cov: 31)
• Consequence: MEN1 NM_001370259.2 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:1
• Conservation: PhyloP100: 9.00

Genes affected

MEN1 (HGNC:7010): (menin 1) This gene encodes menin, a tumor suppressor associated with a syndrome known as multiple endocrine neoplasia type 1. Menin is a scaffold protein that functions in histone modification and epigenetic gene regulation. It is thought to regulate several pathways and processes by altering chromatin structure through the modification of histones. [provided by RefSeq, May 2019]

MEN1 (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_001370259.2.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 11-64809823-TGGGCGGTGAAGCGGGCATAGA-T is Pathogenic according to our data. Variant chr11-64809823-TGGGCGGTGAAGCGGGCATAGA-T is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 403805.We mark this variant Likely_pathogenic, oryginal submissions are: {Uncertain_significance=1, Likely_pathogenic=1}.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MEN1	NM_001370259.2	c.266_286delTCTATGCCCGCTTCACCGCCC	p.Leu89_Ala95del	disruptive_inframe_deletion	2/10	ENST00000450708.7	NP_001357188.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MEN1	ENST00000450708.7	c.266_286delTCTATGCCCGCTTCACCGCCC	p.Leu89_Ala95del	disruptive_inframe_deletion	2/10	5	NM_001370259.2	ENSP00000394933.3

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:1 Uncertain:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not provided Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

GeneDx

Dec 14, 2016

The c.266_286del21 variant in the MEN1 gene has previously been reported in association with multiple endocrine neoplasia type 1 (Lourenco et al., 2007; Toledo et al., 2007; Coutinho et al., 2010). This variant was not observed in approximately 6,500 individuals of European and African American ancestry in the NHLBI Exome Sequencing Project, indicating it is not a common benign variant in these populations. The c.266_286del21 variant is an in-frame deletion that results in the loss of seven amino acids, denoted p.Leu89_Ala95del. Five of the deleted residues are conserved across species, and in silico analysis predicts this variant is probably damaging to the protein structure/function. Based on currently available evidence, c.266_286del21 is a strong candidate for a pathogenic variant. However, the possibility it is a rare benign variant cannot be excluded. -

Multiple endocrine neoplasia, type 1 Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Dec 19, 2016

This variant has been reported to segregate with multiple endocrine neoplasia type 1 in 3 members of a single family (PMID: 17555499). This variant is also known as 375del21 in the literature. This sequence change deletes 21 nucleotides from exon 2 of the MEN1 mRNA (c.266_286del). This leads to the deletion of 7 amino acid residues from the MEN1 protein (p.Leu89_Ala95del) but otherwise preserves the integrity of the reading frame. In summary, this is a rare in-frame deletion with uncertain impact on protein function that has been reported in an affected family. It has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. This variant is not present in population databases (ExAC no frequency). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1064792906; hg19: chr11-64577295;