rs1064792915
Variant summary
Our verdict is Pathogenic. Variant got 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_001267550.2(TTN):c.52576_52603del(p.Ala17526Ter) variant causes a frameshift change involving the alteration of a conserved nucleotide. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 32)
Consequence
TTN
NM_001267550.2 frameshift
NM_001267550.2 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 9.27
Genes affected
TTN (HGNC:12403): (titin) This gene encodes a large abundant protein of striated muscle. The product of this gene is divided into two regions, a N-terminal I-band and a C-terminal A-band. The I-band, which is the elastic part of the molecule, contains two regions of tandem immunoglobulin domains on either side of a PEVK region that is rich in proline, glutamate, valine and lysine. The A-band, which is thought to act as a protein-ruler, contains a mixture of immunoglobulin and fibronectin repeats, and possesses kinase activity. An N-terminal Z-disc region and a C-terminal M-line region bind to the Z-line and M-line of the sarcomere, respectively, so that a single titin molecule spans half the length of a sarcomere. Titin also contains binding sites for muscle associated proteins so it serves as an adhesion template for the assembly of contractile machinery in muscle cells. It has also been identified as a structural protein for chromosomes. Alternative splicing of this gene results in multiple transcript variants. Considerable variability exists in the I-band, the M-line and the Z-disc regions of titin. Variability in the I-band region contributes to the differences in elasticity of different titin isoforms and, therefore, to the differences in elasticity of different muscle types. Mutations in this gene are associated with familial hypertrophic cardiomyopathy 9, and autoantibodies to titin are produced in patients with the autoimmune disease scleroderma. [provided by RefSeq, Feb 2012]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 16 ACMG points.
PVS1
?
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
?
Variant 2-178608279-AATAAGCCATCTACATTGGCTTTCAAGGC-A is Pathogenic according to our data. Variant chr2-178608279-AATAAGCCATCTACATTGGCTTTCAAGGC-A is described in ClinVar as [Likely_pathogenic]. Clinvar id is 404765.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | UniProt |
---|---|---|---|---|---|---|---|
TTN | NM_001267550.2 | c.52576_52603del | p.Ala17526Ter | frameshift_variant | 275/363 | ENST00000589042.5 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|
TTN | ENST00000589042.5 | c.52576_52603del | p.Ala17526Ter | frameshift_variant | 275/363 | 5 | NM_001267550.2 | P1 | |
TTN-AS1 | ENST00000659121.1 | n.502+10601_502+10628del | intron_variant, non_coding_transcript_variant |
Frequencies
GnomAD3 genomes ? Cov.: 32
GnomAD3 genomes
?
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome ? Cov.: 32
GnomAD4 genome
?
Cov.:
32
ClinVar
Significance: Likely pathogenic
Submissions summary: Pathogenic:3
Revision: criteria provided, multiple submitters, no conflicts
LINK: link
Submissions by phenotype
Autosomal recessive limb-girdle muscular dystrophy type 2J;C1858763:Dilated cardiomyopathy 1G Pathogenic:1
Likely pathogenic, criteria provided, single submitter | clinical testing | Invitae | Sep 13, 2022 | This variant has not been reported in the literature in individuals affected with TTN-related conditions. In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. This variant is located in the A band of TTN (PMID: 25589632). Truncating variants in this region are significantly overrepresented in patients affected with dilated cardiomyopathy (PMID: 25589632). Truncating variants in this region have also been reported in individuals affected with autosomal recessive centronuclear myopathy (PMID: 23975875). ClinVar contains an entry for this variant (Variation ID: 404765). This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Ala17526*) in the TTN gene. While this is not anticipated to result in nonsense mediated decay, it is expected to create a truncated TTN protein. - |
Dilated cardiomyopathy 1G Pathogenic:1
Likely pathogenic, criteria provided, single submitter | clinical testing | Invitae | Oct 03, 2016 | This sequence change deletes 28 nucleotide from exon 275 of the TTN mRNA (c.52576_52603delGCCTTGAAAGCCAATGTAGATGGCTTAT), causing a frameshift at codon 17526. This creates a premature translational stop signal in the last exon of the TTN mRNA (p.Ala17526*). While this is not anticipated to result in nonsense mediated decay, it is expected to result in a truncated TTN protein. This variant is found in the A-band of this gene. While this particular variant has not been reported in the literature, truncating variants in the A-band of TTN are significantly overrepresented in patients with dilated cardiomyopathy and are considered to be likely pathogenic for the disease (PMID: 25589632). For these reasons, this variant has been classified as Likely Pathogenic. - |
Cardiovascular phenotype Pathogenic:1
Likely pathogenic, criteria provided, single submitter | clinical testing | Ambry Genetics | Jan 20, 2023 | The c.25381_25408del28 variant, located in coding exon 102 of the TTN gene, results from a deletion of 28 nucleotides at nucleotide positions 25381 to 25408, causing a translational frameshift with a predicted alternate stop codon (p.A8461*). This exon is located in the A-band region of the N2-B isoform of the titin protein and is constitutively expressed in TTN transcripts (percent spliced in or PSI 100%). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. While truncating variants in TTN are present in 1-3% of the general population, truncating variants in the A-band are the most common cause of dilated cardiomyopathy (DCM) (Herman DS et al. N. Engl. J. Med., 2012 Feb;366:619-28; Roberts AM et al. Sci Transl Med, 2015 Jan;7:270ra6). TTN truncating variants encoded in constitutive exons (PSI >90%) have been found to be significantly associated with DCM regardless of their position in titin (Schafer S et al. Nat. Genet., 2017 01;49:46-53). Based on the majority of available evidence to date, this variant is likely to be pathogenic. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at