rs1064792927

Variant names:

• chr12-32877928-G-GCGCTCTCCTCCCGCTGGAATCCA
• rs1064792927
• NM_001005242.3:c.929_951dupTGGATTCCAGCGGGAGGAGAGCG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_001005242.3(PKP2):​c.929_951dupTGGATTCCAGCGGGAGGAGAGCG​(p.His318TrpfsTer10) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. A317A) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: PKP2 NM_001005242.3 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: -1.26
• Publications: 1 publications found

Genes affected

PKP2 (HGNC:9024): (plakophilin 2) This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This gene may regulate the signaling activity of beta-catenin and is required to maintain transcription of genes that control intracellular calcium cycling including ryanodine receptor 2, ankyrin-B, triadin, and calcium channel, voltage-dependent, L type, alpha 1C. Mutations in this gene are associated with different inherited cardiac conditions including Arrythmogenic Cardiomyopathy, Brugada Syndrome, and Idiopathic Ventricular Fibrillation. A processed pseudogene with high similarity to this gene has been mapped to chromosome 12p13. [provided by RefSeq, May 2022]

PKP2 Gene-Disease associations (from GenCC):

• arrhythmogenic right ventricular cardiomyopathy

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• arrhythmogenic right ventricular dysplasia 9

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• left ventricular noncompaction

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Brugada syndrome

  Inheritance: AD Classification: LIMITED Submitted by: Genomics England PanelApp
• Brugada syndrome 1

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• catecholaminergic polymorphic ventricular tachycardia

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• dilated cardiomyopathy

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ENSG00000309501 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 12-32877928-G-GCGCTCTCCTCCCGCTGGAATCCA is Pathogenic according to our data. Variant chr12-32877928-G-GCGCTCTCCTCCCGCTGGAATCCA is described in ClinVar as Pathogenic. ClinVar VariationId is 406552.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001005242.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PKP2	NM_001005242.3	MANE Select	c.929_951dupTGGATTCCAGCGGGAGGAGAGCG	p.His318TrpfsTer10	frameshift	Exon 3 of 13	NP_001005242.2
	PKP2	NM_004572.4		c.929_951dupTGGATTCCAGCGGGAGGAGAGCG	p.His318TrpfsTer10	frameshift	Exon 3 of 14	NP_004563.2
	PKP2	NM_001407155.1		c.929_951dupTGGATTCCAGCGGGAGGAGAGCG	p.His318TrpfsTer10	frameshift	Exon 3 of 12	NP_001394084.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PKP2	ENST00000340811.9	TSL:1 MANE Select	c.929_951dupTGGATTCCAGCGGGAGGAGAGCG	p.His318TrpfsTer10	frameshift	Exon 3 of 13	ENSP00000342800.5
	PKP2	ENST00000070846.11	TSL:1	c.929_951dupTGGATTCCAGCGGGAGGAGAGCG	p.His318TrpfsTer10	frameshift	Exon 3 of 14	ENSP00000070846.6
	PKP2	ENST00000700559.2		c.929_951dupTGGATTCCAGCGGGAGGAGAGCG	p.His318TrpfsTer10	frameshift	Exon 3 of 12	ENSP00000515065.2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD2 exomes AF: 0.00000399 AC: 1 AN: 250864 AF XY: 0.00000737

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000883

Gnomad OTH exome AF: 0.00

GnomAD4 exome Cov.: 33

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
1	-	-	Arrhythmogenic right ventricular dysplasia 9 (1)
1	-	-	Cardiovascular phenotype (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-1.3
Mutation Taster		=3/197	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1064792927; hg19: chr12-33030862;