rs1064792927
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_001005242.3(PKP2):c.929_951dupTGGATTCCAGCGGGAGGAGAGCG(p.His318TrpfsTer10) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. A317A) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_001005242.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- arrhythmogenic right ventricular cardiomyopathyInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- arrhythmogenic right ventricular dysplasia 9Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
- left ventricular noncompactionInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Brugada syndromeInheritance: AD Classification: LIMITED Submitted by: Genomics England PanelApp
- Brugada syndrome 1Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
- catecholaminergic polymorphic ventricular tachycardiaInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
- dilated cardiomyopathyInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001005242.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PKP2 | NM_001005242.3 | MANE Select | c.929_951dupTGGATTCCAGCGGGAGGAGAGCG | p.His318TrpfsTer10 | frameshift | Exon 3 of 13 | NP_001005242.2 | ||
| PKP2 | NM_004572.4 | c.929_951dupTGGATTCCAGCGGGAGGAGAGCG | p.His318TrpfsTer10 | frameshift | Exon 3 of 14 | NP_004563.2 | |||
| PKP2 | NM_001407155.1 | c.929_951dupTGGATTCCAGCGGGAGGAGAGCG | p.His318TrpfsTer10 | frameshift | Exon 3 of 12 | NP_001394084.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PKP2 | ENST00000340811.9 | TSL:1 MANE Select | c.929_951dupTGGATTCCAGCGGGAGGAGAGCG | p.His318TrpfsTer10 | frameshift | Exon 3 of 13 | ENSP00000342800.5 | ||
| PKP2 | ENST00000070846.11 | TSL:1 | c.929_951dupTGGATTCCAGCGGGAGGAGAGCG | p.His318TrpfsTer10 | frameshift | Exon 3 of 14 | ENSP00000070846.6 | ||
| PKP2 | ENST00000700559.2 | c.929_951dupTGGATTCCAGCGGGAGGAGAGCG | p.His318TrpfsTer10 | frameshift | Exon 3 of 12 | ENSP00000515065.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD2 exomes AF: 0.00000399 AC: 1AN: 250864 AF XY: 0.00000737 show subpopulations
GnomAD4 exome Cov.: 33
GnomAD4 genome Cov.: 32
ClinVar
ClinVar submissions as Germline
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at