rs1064792928

Variant names:

• chr12-32792602-TGGCTCTGTTAACTATGACACATTCCTTGTTCATGTTCTTACCTTCTTGTA-T
• rs1064792928
• NM_001005242.3:c.2437_2445+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1_Moderate PM2 PP5_Very_Strong

The NM_001005242.3(PKP2):​c.2437_2445+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC​(p.Tyr813_Lys815del) variant causes a splice donor, conservative inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 7.0e-7 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: PKP2 NM_001005242.3 splice_donor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:4
• Conservation: PhyloP100: 1.38

Genes affected

PKP2 (HGNC:9024): (plakophilin 2) This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This gene may regulate the signaling activity of beta-catenin and is required to maintain transcription of genes that control intracellular calcium cycling including ryanodine receptor 2, ankyrin-B, triadin, and calcium channel, voltage-dependent, L type, alpha 1C. Mutations in this gene are associated with different inherited cardiac conditions including Arrythmogenic Cardiomyopathy, Brugada Syndrome, and Idiopathic Ventricular Fibrillation. A processed pseudogene with high similarity to this gene has been mapped to chromosome 12p13. [provided by RefSeq, May 2022]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates 0.030628480509148792 fraction of the geneNo cryptic splice site detected. Exon removal results in frameshift change.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 12-32792602-TGGCTCTGTTAACTATGACACATTCCTTGTTCATGTTCTTACCTTCTTGTA-T is Pathogenic according to our data. Variant chr12-32792602-TGGCTCTGTTAACTATGACACATTCCTTGTTCATGTTCTTACCTTCTTGTA-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 406553.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr12-32792602-TGGCTCTGTTAACTATGACACATTCCTTGTTCATGTTCTTACCTTCTTGTA-T is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PKP2	NM_001005242.3	c.2437_2445+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC	p.Tyr813_Lys815del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 12 of 13	ENST00000340811.9	NP_001005242.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PKP2	ENST00000340811.9	c.2437_2445+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC	p.Tyr813_Lys815del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 12 of 13	1	NM_001005242.3	ENSP00000342800.5

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 7.02e-7 AC: 1 AN: 1425258 Hom.: 0 AF XY: 0.00000141 AC XY: 1 AN XY: 711306

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 9.27e-7

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Arrhythmogenic right ventricular dysplasia 9 Pathogenic:1

Dec 05, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant results in the deletion of part of exon 13 (c.2569_2577+41del) of the PKP2 gene. While this variant is not anticipated to result in nonsense mediated decay, it likely alters RNA splicing and results in a disrupted protein product. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individuals with arrhythmogenic right ventricular cardiomyopathy (PMID: 16893920, 29221435; internal data). ClinVar contains an entry for this variant (Variation ID: 406553). Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. -

Cardiomyopathy Pathogenic:1

Apr 08, 2021

Color Diagnostics, LLC DBA Color Health

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant causes a deletion of the last 9 nucleotides of exon 13 and the first 41 nucleotides of intron 13 of the PKP2 gene. This variant is also known as 2569del50 in the literature. Although functional studies have not been reported for this variant, it is predicted to result in a premature protein truncation (PMID: 16893920) or a frameshift and C-terminal extension due to the use of a cryptic splice donor site, thereby adversely impacting PKP2 function. This variant has been reported in multiple individual affected with arrhythmogenic cardiomyopathy (PMID: 16893920, 29221435; ClinVar SCV000545244.4). This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Loss of PKP2 function is a known mechanism of disease. Based on the available evidence, this variant is classified as Likely Pathogenic. -

not provided Pathogenic:1

Jan 08, 2024

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Canonical splice site variant predicted to result in a null allele in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 25825460, 16893920, 29221435) -

Familial isolated arrhythmogenic right ventricular dysplasia Pathogenic:1

Oct 19, 2022

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: PKP2 c.2569_2577+41del50 (also known as 2569del50) is a deletion that impacts the last nine nucleotides of exon 13 and the first 41 nucleotides of intron 13. The variant was absent in 251362 control chromosomes. c.2569_2577+41del50 has been reported in the literature in multiple individuals affected with Arrhythmogenic Right Ventricular Dysplasia/Cardiomyopathy, and has been reported with potential digenic inheritance and low penetrance (Konig_2017, Antoniades_2006, Protonotarios_2016). These data indicate that the variant is likely to be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. Two clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation. All laboratories classified the variant as likely pathogenic. Based on the evidence outlined above, the variant was classified as likely pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1064792928; hg19: chr12-32945536;