rs1064792928

Variant names:

• chr12-32792602-TGGCTCTGTTAACTATGACACATTCCTTGTTCATGTTCTTACCTTCTTGTA-T
• rs1064792928
• NM_001005242.3:c.2437_2445+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1_Moderate PP5_Very_Strong

The NM_001005242.3(PKP2):​c.2437_2445+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC​(p.Tyr813_Lys815del) variant causes a splice donor, conservative inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 7.0e-7 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: PKP2 NM_001005242.3 splice_donor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:5
• Conservation: PhyloP100: 1.38
• Publications: 0 publications found

Genes affected

PKP2 (HGNC:9024): (plakophilin 2) This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This gene may regulate the signaling activity of beta-catenin and is required to maintain transcription of genes that control intracellular calcium cycling including ryanodine receptor 2, ankyrin-B, triadin, and calcium channel, voltage-dependent, L type, alpha 1C. Mutations in this gene are associated with different inherited cardiac conditions including Arrythmogenic Cardiomyopathy, Brugada Syndrome, and Idiopathic Ventricular Fibrillation. A processed pseudogene with high similarity to this gene has been mapped to chromosome 12p13. [provided by RefSeq, May 2022]

PKP2 Gene-Disease associations (from GenCC):

• arrhythmogenic right ventricular cardiomyopathy

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• arrhythmogenic right ventricular dysplasia 9

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• left ventricular noncompaction

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Brugada syndrome

  Inheritance: AD Classification: LIMITED Submitted by: Genomics England PanelApp
• Brugada syndrome 1

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• catecholaminergic polymorphic ventricular tachycardia

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• dilated cardiomyopathy

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates 0.030628480509148792 fraction of the geneNo cryptic splice site detected. Exon removal results in frameshift change.
• PP5: Variant 12-32792602-TGGCTCTGTTAACTATGACACATTCCTTGTTCATGTTCTTACCTTCTTGTA-T is Pathogenic according to our data. Variant chr12-32792602-TGGCTCTGTTAACTATGACACATTCCTTGTTCATGTTCTTACCTTCTTGTA-T is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 406553.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001005242.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PKP2	NM_001005242.3	MANE Select	c.2437_2445+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC	p.Tyr813_Lys815del	splice_donor conservative_inframe_deletion splice_region intron	Exon 12 of 13	NP_001005242.2
	PKP2	NM_004572.4		c.2569_2577+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC	p.Tyr857_Lys859del	splice_donor conservative_inframe_deletion splice_region intron	Exon 13 of 14	NP_004563.2
	PKP2	NM_001407155.1		c.2247_2255+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC	p.Thr750_Arg752del	splice_donor disruptive_inframe_deletion splice_region intron	Exon 11 of 12	NP_001394084.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PKP2	ENST00000340811.9	TSL:1 MANE Select	c.2437_2445+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC	p.Tyr813_Lys815del	splice_donor conservative_inframe_deletion splice_region intron	Exon 12 of 13	ENSP00000342800.5
	PKP2	ENST00000070846.11	TSL:1	c.2569_2577+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC	p.Tyr857_Lys859del	splice_donor conservative_inframe_deletion splice_region intron	Exon 13 of 14	ENSP00000070846.6
	PKP2	ENST00000700560.1		n.1652_1701delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC		non_coding_transcript_exon	Exon 10 of 10

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 7.02e-7 AC: 1 AN: 1425258 Hom.: 0 AF XY: 0.00000141 AC XY: 1 AN XY: 711306

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 32656

American (AMR) AF: 0.00 AC: 0 AN: 44688

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25910

East Asian (EAS) AF: 0.00 AC: 0 AN: 39514

South Asian (SAS) AF: 0.00 AC: 0 AN: 85534

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53412

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5694

European-Non Finnish (NFE) AF: 9.27e-7 AC: 1 AN: 1078724

Other (OTH) AF: 0.00 AC: 0 AN: 59126

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:5

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Arrhythmogenic right ventricular dysplasia 9 Pathogenic:1

Dec 05, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant results in the deletion of part of exon 13 (c.2569_2577+41del) of the PKP2 gene. While this variant is not anticipated to result in nonsense mediated decay, it likely alters RNA splicing and results in a disrupted protein product. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individuals with arrhythmogenic right ventricular cardiomyopathy (PMID: 16893920, 29221435; internal data). ClinVar contains an entry for this variant (Variation ID: 406553). Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic.

Cardiomyopathy Pathogenic:1

Apr 08, 2021

Color Diagnostics, LLC DBA Color Health

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant causes a deletion of the last 9 nucleotides of exon 13 and the first 41 nucleotides of intron 13 of the PKP2 gene. This variant is also known as 2569del50 in the literature. Although functional studies have not been reported for this variant, it is predicted to result in a premature protein truncation (PMID: 16893920) or a frameshift and C-terminal extension due to the use of a cryptic splice donor site, thereby adversely impacting PKP2 function. This variant has been reported in multiple individual affected with arrhythmogenic cardiomyopathy (PMID: 16893920, 29221435; ClinVar SCV000545244.4). This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Loss of PKP2 function is a known mechanism of disease. Based on the available evidence, this variant is classified as Likely Pathogenic.

not provided Pathogenic:1

Jan 08, 2024

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Canonical splice site variant predicted to result in a null allele in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 25825460, 16893920, 29221435)

Cardiovascular phenotype Pathogenic:1

Mar 18, 2025

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.2569_2577+41del50 pathogenic mutation results from a deletion of 50 nucleotides between positions c.2569 and c.2569 and involves the canonical splice donor site after coding exon 13 of the PKP2 gene. This variant (also referred to as c.2569del50) was reported in individual(s) with features consistent with arrhythmogenic right ventricular cardiomyopathy (ARVC) (Antoniades L et al. Eur Heart J. 2006 Sep;27(18):2208-16; König E et al. BMC Med Genet. 2017 Dec;18(1):145). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). This alteration occurs at the 3' terminus of thePKP2 gene, is not expected to trigger nonsense-mediated mRNAdecay and may result in elongation of the protein. Alterations that disrupt the canonical splice site are expected to cause aberrant splicing, resulting in an abnormal protein or a transcript that is subject to nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation.

Familial isolated arrhythmogenic right ventricular dysplasia Pathogenic:1

Oct 19, 2022

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: PKP2 c.2569_2577+41del50 (also known as 2569del50) is a deletion that impacts the last nine nucleotides of exon 13 and the first 41 nucleotides of intron 13. The variant was absent in 251362 control chromosomes. c.2569_2577+41del50 has been reported in the literature in multiple individuals affected with Arrhythmogenic Right Ventricular Dysplasia/Cardiomyopathy, and has been reported with potential digenic inheritance and low penetrance (Konig_2017, Antoniades_2006, Protonotarios_2016). These data indicate that the variant is likely to be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. Two clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation. All laboratories classified the variant as likely pathogenic. Based on the evidence outlined above, the variant was classified as likely pathogenic.

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.4
Mutation Taster		=17/183	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1064792928; hg19: chr12-32945536;