rs1064792932

Positions:

• chr19-11426498-TCCAGCTCATGTTTGGTCCTCA-T

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_145045.5(ODAD3):​c.767_787del​(p.Val256_Leu262del) variant causes a inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000684 in 1,461,852 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: ODAD3 NM_145045.5 inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.33

Genes affected

ODAD3 (HGNC:28303): (outer dynein arm docking complex subunit 3) This gene encodes a protein containing coiled-coil domains. The encoded protein functions in outer dynein arm assembly and is required for motile cilia function. Mutations in this gene result in primary ciliary dyskinesia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_145045.5.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
ODAD3	NM_145045.5	c.767_787del	p.Val256_Leu262del	inframe_deletion	6/13	ENST00000356392.9
ODAD3	NM_001302453.1	c.605_625del	p.Val202_Leu208del	inframe_deletion	6/13
ODAD3	NM_001302454.2	c.587_607del	p.Val196_Leu202del	inframe_deletion	4/11
ODAD3	XM_017026241.2	c.767_787del	p.Val256_Leu262del	inframe_deletion	6/9

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
ODAD3	ENST00000356392.9	c.767_787del	p.Val256_Leu262del	inframe_deletion	6/13	1	NM_145045.5	P2
ODAD3	ENST00000591179.5	c.587_607del	p.Val196_Leu202del	inframe_deletion	4/11	1		A2
ODAD3	ENST00000586836.5	c.194_214del	p.Val65_Leu71del	inframe_deletion	6/13	2		A2
ODAD3	ENST00000591345.5	c.*686_*706del		3_prime_UTR_variant, NMD_transcript_variant	7/14	5

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome AF: 6.84e-7 AC: 1 AN: 1461852 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 727230

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000116

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 31

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Primary ciliary dyskinesia 30 Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Sep 27, 2016

In summary, this variant is a novel in-frame deletion with uncertain impact on protein function. It has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. This variant is not present in population databases (ExAC no frequency) and has not been reported in the literature in individuals with a CCDC151-related disease. This sequence change deletes 21 nucleotides from exon 6 of the CCDC151 mRNA (c.767_787delTGAGGACCAAACATGAGCTGG). This leads to the deletion of 7 amino acid residues in the CCDC151 protein (p.Val256_Leu262del) but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1064792932; hg19: chr19-11537318;