rs1064792932

Variant names:

• chr19-11426498-TCCAGCTCATGTTTGGTCCTCA-T
• rs1064792932
• NM_145045.5:c.767_787delTGAGGACCAAACATGAGCTGG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The ENST00000356392.9(ODAD3):​c.767_787delTGAGGACCAAACATGAGCTGG​(p.Val256_Leu262del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000684 in 1,461,852 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: ODAD3 ENST00000356392.9 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.33
• Publications: 0 publications found

Genes affected

ODAD3 (HGNC:28303): (outer dynein arm docking complex subunit 3) This gene encodes a protein containing coiled-coil domains. The encoded protein functions in outer dynein arm assembly and is required for motile cilia function. Mutations in this gene result in primary ciliary dyskinesia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]

ODAD3 Gene-Disease associations (from GenCC):

• primary ciliary dyskinesia 30

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, G2P
• primary ciliary dyskinesia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in ENST00000356392.9.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000356392.9. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ODAD3	NM_145045.5	MANE Select	c.767_787delTGAGGACCAAACATGAGCTGG	p.Val256_Leu262del	disruptive_inframe_deletion	Exon 6 of 13	NP_659482.3
	ODAD3	NM_001302453.1		c.605_625delTGAGGACCAAACATGAGCTGG	p.Val202_Leu208del	disruptive_inframe_deletion	Exon 6 of 13	NP_001289382.1
	ODAD3	NM_001302454.2		c.587_607delTGAGGACCAAACATGAGCTGG	p.Val196_Leu202del	disruptive_inframe_deletion	Exon 4 of 11	NP_001289383.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ODAD3	ENST00000356392.9	TSL:1 MANE Select	c.767_787delTGAGGACCAAACATGAGCTGG	p.Val256_Leu262del	disruptive_inframe_deletion	Exon 6 of 13	ENSP00000348757.3
	ODAD3	ENST00000591179.5	TSL:1	c.587_607delTGAGGACCAAACATGAGCTGG	p.Val196_Leu202del	disruptive_inframe_deletion	Exon 4 of 11	ENSP00000466800.1
	ODAD3	ENST00000586836.5	TSL:2	c.194_214delTGAGGACCAAACATGAGCTGG	p.Val65_Leu71del	disruptive_inframe_deletion	Exon 6 of 13	ENSP00000467429.1

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD2 exomes AF: 0.00 AC: 0 AN: 249450 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 6.84e-7 AC: 1 AN: 1461852 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 727230

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33480

American (AMR) AF: 0.00 AC: 0 AN: 44720

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26132

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.0000116 AC: 1 AN: 86256

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53416

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1111986

Other (OTH) AF: 0.00 AC: 0 AN: 60394

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 31

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Primary ciliary dyskinesia 30 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1064792932; hg19: chr19-11537318;